Incidental Mutation 'R1452:Des'
ID161039
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75363477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect probably damaging
Transcript: ENSMUST00000027409
AA Change: S343P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: S343P

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152799
Meta Mutation Damage Score 0.7210 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0032:Des UTSW 1 75362166 missense possibly damaging 0.87
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1271:Des UTSW 1 75360646 missense probably benign 0.01
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4182:Des UTSW 1 75362584 missense probably benign 0.00
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R4383:Des UTSW 1 75360769 missense possibly damaging 0.94
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5787:Des UTSW 1 75363646 missense probably damaging 0.98
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
R7359:Des UTSW 1 75360952 missense probably damaging 1.00
R7467:Des UTSW 1 75362961 missense possibly damaging 0.48
R7798:Des UTSW 1 75362359 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACACTTTGAGCCCAGTACAGACC -3'
(R):5'- AGGCCATCTTCACATTGAGCAGG -3'

Sequencing Primer
(F):5'- CTAAGGAATCAGATGTGTCACCCTG -3'
(R):5'- CATTGAGCAGGTCCTGGTACTC -3'
Posted On2014-03-14