Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Des'

161039

Institutional Source

Beutler Lab

Gene Symbol

Des

Ensembl Gene

ENSMUSG00000026208

Gene Name

desmin

Synonyms

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75360329-75368579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75363477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 343 (S343P)

Ref Sequence

ENSEMBL: ENSMUSP00000027409 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027409]

AlphaFold

P31001

Predicted Effect

probably damaging
Transcript: ENSMUST00000027409
AA Change: S343P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: S343P

Domain	Start	End	E-Value	Type
Pfam:Filament_head	9	105	1.3e-25	PFAM
Filament	106	414	7.41e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144894

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152799

Meta Mutation Damage Score

0.7210

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Des

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01285:Des	APN	1	75362583	missense	probably benign	0.02
IGL02416:Des	APN	1	75362728	critical splice donor site	probably null
IGL02953:Des	APN	1	75363644	missense	possibly damaging	0.95
IGL03156:Des	APN	1	75362996	missense	probably damaging	1.00
IGL03288:Des	APN	1	75362341	missense	possibly damaging	0.79
R0032:Des	UTSW	1	75362166	missense	possibly damaging	0.87
R0849:Des	UTSW	1	75360628	missense	probably benign
R0885:Des	UTSW	1	75360730	missense	probably damaging	1.00
R1271:Des	UTSW	1	75360646	missense	probably benign	0.01
R1559:Des	UTSW	1	75360586	missense	probably benign	0.11
R1929:Des	UTSW	1	75363493	missense	probably damaging	0.99
R2144:Des	UTSW	1	75366804	missense	probably benign	0.45
R2145:Des	UTSW	1	75363464	splice site	probably benign
R2271:Des	UTSW	1	75363493	missense	probably damaging	0.99
R4182:Des	UTSW	1	75362584	missense	probably benign	0.00
R4184:Des	UTSW	1	75362584	missense	probably benign	0.00
R4383:Des	UTSW	1	75360769	missense	possibly damaging	0.94
R5268:Des	UTSW	1	75362928	missense	possibly damaging	0.50
R5787:Des	UTSW	1	75363646	missense	probably damaging	0.98
R5974:Des	UTSW	1	75362984	missense	probably benign	0.10
R6044:Des	UTSW	1	75363469	critical splice acceptor site	probably null
R6985:Des	UTSW	1	75366787	missense	possibly damaging	0.80
R7359:Des	UTSW	1	75360952	missense	probably damaging	1.00
R7467:Des	UTSW	1	75362961	missense	possibly damaging	0.48
R7798:Des	UTSW	1	75362359	missense	probably damaging	0.96
R8878:Des	UTSW	1	75360493	missense	unknown
R8957:Des	UTSW	1	75363651	missense	probably damaging	1.00
R9245:Des	UTSW	1	75366762	missense	probably benign	0.17
R9258:Des	UTSW	1	75363645	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GACACTTTGAGCCCAGTACAGACC -3'
(R):5'- AGGCCATCTTCACATTGAGCAGG -3'

Sequencing Primer
(F):5'- CTAAGGAATCAGATGTGTCACCCTG -3'
(R):5'- CATTGAGCAGGTCCTGGTACTC -3'

Posted On

2014-03-14