Incidental Mutation 'R1452:Adgre4'
ID 161104
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene ENSMUSG00000032915
Gene Name adhesion G protein-coupled receptor E4
Synonyms Gpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1452 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 55749984-55853662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55784996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 85 (E85D)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
AlphaFold Q91ZE5
Predicted Effect probably benign
Transcript: ENSMUST00000025004
AA Change: E85D

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: E85D

signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 splice site probably benign
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 splice site probably benign
IGL01501:Adgre4 APN 17 55802002 splice site probably benign
IGL01510:Adgre4 APN 17 55818760 critical splice donor site probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 splice site probably benign
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 splice site probably benign
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0111:Adgre4 UTSW 17 55817073 missense possibly damaging 0.92
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1330:Adgre4 UTSW 17 55778814 missense probably benign 0.36
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site probably benign
R4222:Adgre4 UTSW 17 55785121 missense probably damaging 1.00
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6426:Adgre4 UTSW 17 55802196 missense probably benign 0.18
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
R6680:Adgre4 UTSW 17 55791959 missense probably benign 0.09
R7086:Adgre4 UTSW 17 55820649 missense probably benign 0.00
R7442:Adgre4 UTSW 17 55852340 missense probably benign 0.04
R7467:Adgre4 UTSW 17 55791952 missense probably benign 0.00
R7875:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R8007:Adgre4 UTSW 17 55814233 missense probably damaging 0.99
R8096:Adgre4 UTSW 17 55820700 missense probably damaging 1.00
R8172:Adgre4 UTSW 17 55797769 missense probably benign 0.00
R8512:Adgre4 UTSW 17 55818760 critical splice donor site probably null
R8972:Adgre4 UTSW 17 55802189 missense probably damaging 1.00
R9018:Adgre4 UTSW 17 55791993 missense probably benign 0.00
R9049:Adgre4 UTSW 17 55785094 missense probably benign 0.05
S24628:Adgre4 UTSW 17 55852288 missense probably benign 0.03
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Z1177:Adgre4 UTSW 17 55814152 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggaaatgacataactccacagac -3'
Posted On 2014-03-14