Incidental Mutation 'R1491:Zmym4'
ID163723
Institutional Source Beutler Lab
Gene Symbol Zmym4
Ensembl Gene ENSMUSG00000042446
Gene Namezinc finger, MYM-type 4
SynonymsZfp262, 6330503C17Rik
MMRRC Submission 039543-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R1491 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126861939-126968135 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 126882312 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000106108]
Predicted Effect probably null
Transcript: ENSMUST00000106108
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135003
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik T A 12: 112,415,055 noncoding transcript Het
Acss3 A G 10: 106,937,308 S606P probably benign Het
Adamts13 C T 2: 26,978,315 T146M probably damaging Het
Adora2b G A 11: 62,265,537 V271M probably benign Het
Agpat5 A G 8: 18,846,723 Y55C probably damaging Het
AI987944 A C 7: 41,374,348 Y402* probably null Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Arfgap2 A G 2: 91,274,859 K423E probably damaging Het
Arfgef3 A T 10: 18,646,554 S575T probably damaging Het
Arhgap24 A G 5: 102,860,332 I40V possibly damaging Het
Arhgef7 T C 8: 11,819,733 probably null Het
Arid1a C A 4: 133,720,926 S477I unknown Het
Armc7 T C 11: 115,476,203 V58A probably damaging Het
Arrdc5 A T 17: 56,294,222 I301N probably damaging Het
Capn15 G A 17: 25,964,479 P343S probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cgn C T 3: 94,763,228 R1002Q probably damaging Het
Clstn3 A T 6: 124,437,490 I759N possibly damaging Het
Cops5 A G 1: 10,034,018 V166A possibly damaging Het
Cramp1l G T 17: 24,972,349 T1046K probably benign Het
Cthrc1 T G 15: 39,086,677 V143G probably damaging Het
Cul9 G A 17: 46,538,564 Q552* probably null Het
Cyp27b1 A T 10: 127,051,088 D391V probably damaging Het
Dcun1d2 A G 8: 13,281,040 L30S probably damaging Het
Dsc3 T C 18: 19,987,034 E189G probably damaging Het
Dst T G 1: 34,154,594 S295A probably damaging Het
Dusp22 A G 13: 30,708,815 T192A probably benign Het
Esp24 A T 17: 39,038,285 M1L probably null Het
Evc2 G A 5: 37,393,197 probably null Het
Fgd6 A G 10: 94,044,832 N516S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Fut8 T A 12: 77,448,674 I346K possibly damaging Het
Gata3 A C 2: 9,877,390 V32G probably damaging Het
Glrb A T 3: 80,911,975 C39S possibly damaging Het
Gm16432 C T 1: 178,015,929 T69I possibly damaging Het
Gpr171 A G 3: 59,097,595 V253A probably benign Het
Hdac5 A G 11: 102,201,253 V670A probably benign Het
Hmgxb3 T C 18: 61,133,908 S1085G probably benign Het
Hspa4l A G 3: 40,786,794 N746S probably benign Het
Hyal5 A G 6: 24,877,903 T333A probably benign Het
Ippk T C 13: 49,461,593 V484A probably benign Het
Jmjd8 A T 17: 25,829,292 T33S possibly damaging Het
Kctd19 T A 8: 105,387,062 I660L possibly damaging Het
Lrat A G 3: 82,903,342 V124A probably benign Het
Madcam1 A G 10: 79,666,524 I281V probably benign Het
Mast2 T A 4: 116,316,491 I455F possibly damaging Het
Mroh7 A G 4: 106,703,058 L683P probably benign Het
Myo15b C A 11: 115,886,857 probably null Het
Ncam1 T C 9: 49,505,549 E814G probably benign Het
Ncoa3 A G 2: 166,055,262 T658A probably benign Het
Olfr459 T C 6: 41,771,522 Y259C possibly damaging Het
Olfr53 T G 7: 140,652,737 Y253D probably damaging Het
P2ry13 T C 3: 59,209,518 K280E probably damaging Het
Paqr8 C A 1: 20,934,824 F67L probably benign Het
Pfkfb3 G T 2: 11,493,936 R37S probably damaging Het
Phf14 A G 6: 11,941,479 D310G possibly damaging Het
Phkb A G 8: 85,875,657 S26G possibly damaging Het
Pkd1l2 T A 8: 117,028,408 I1684F probably damaging Het
Plod2 T C 9: 92,606,584 V621A probably benign Het
Plvap T C 8: 71,511,472 N82S probably damaging Het
Pomgnt2 A G 9: 121,982,260 V485A probably damaging Het
Psmd9 A G 5: 123,228,347 E14G probably benign Het
Pwwp2b A G 7: 139,255,963 E440G probably damaging Het
Rasgrp1 G A 2: 117,282,619 Q771* probably null Het
Rft1 C T 14: 30,666,787 Q223* probably null Het
Rgs22 C A 15: 36,092,901 V409F probably damaging Het
Rgsl1 G A 1: 153,825,926 P261S possibly damaging Het
Rpl7a A G 2: 26,911,115 N38S probably damaging Het
Sh3rf2 T A 18: 42,053,939 F41Y probably damaging Het
Spata6 T A 4: 111,746,191 S34R probably damaging Het
Sult2a3 A T 7: 14,122,942 Y18N probably benign Het
Tapt1 A G 5: 44,218,102 probably null Het
Tex2 A T 11: 106,503,640 C615S possibly damaging Het
Trim43b T C 9: 89,087,612 K261R possibly damaging Het
Unc5c T A 3: 141,789,822 M484K probably damaging Het
Vezf1 T A 11: 88,073,747 S242T probably damaging Het
Vmn2r1 A G 3: 64,089,613 Y230C probably damaging Het
Vmn2r94 A G 17: 18,257,703 S149P probably damaging Het
Wfdc1 T A 8: 119,666,666 probably null Het
Zfp975 T C 7: 42,662,812 T126A probably benign Het
Other mutations in Zmym4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zmym4 APN 4 126890058 missense probably benign
IGL00845:Zmym4 APN 4 126900613 missense probably benign 0.28
IGL01122:Zmym4 APN 4 126864252 missense probably damaging 1.00
IGL01374:Zmym4 APN 4 126868957 missense probably damaging 1.00
IGL01564:Zmym4 APN 4 126911280 missense possibly damaging 0.84
IGL02014:Zmym4 APN 4 126900669 missense possibly damaging 0.67
IGL02187:Zmym4 APN 4 126870273 missense probably damaging 0.97
IGL02887:Zmym4 APN 4 126948475 missense probably damaging 0.96
IGL03371:Zmym4 APN 4 126915088 missense possibly damaging 0.90
IGL03400:Zmym4 APN 4 126923127 missense probably benign 0.12
foreclosed UTSW 4 126895306 missense probably damaging 1.00
foreshortened UTSW 4 126910936 missense possibly damaging 0.75
R0149:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0361:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0423:Zmym4 UTSW 4 126882319 splice site probably benign
R0532:Zmym4 UTSW 4 126898401 nonsense probably null
R0745:Zmym4 UTSW 4 126902703 splice site probably benign
R1183:Zmym4 UTSW 4 126925839 missense probably damaging 0.99
R1401:Zmym4 UTSW 4 126911169 missense probably benign 0.00
R1446:Zmym4 UTSW 4 126882482 missense probably damaging 1.00
R1566:Zmym4 UTSW 4 126911147 missense possibly damaging 0.94
R1962:Zmym4 UTSW 4 126902670 missense possibly damaging 0.47
R2398:Zmym4 UTSW 4 126923136 missense probably damaging 1.00
R2930:Zmym4 UTSW 4 126925523 missense probably benign 0.00
R3891:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R3892:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R4659:Zmym4 UTSW 4 126948428 splice site probably null
R4702:Zmym4 UTSW 4 126923165 missense probably benign 0.01
R5160:Zmym4 UTSW 4 126870184 missense probably damaging 0.97
R5614:Zmym4 UTSW 4 126910936 missense possibly damaging 0.75
R5773:Zmym4 UTSW 4 126905370 missense possibly damaging 0.52
R6450:Zmym4 UTSW 4 126895306 missense probably damaging 1.00
R6741:Zmym4 UTSW 4 126915085 missense possibly damaging 0.80
R7023:Zmym4 UTSW 4 126868800 missense probably damaging 1.00
R7315:Zmym4 UTSW 4 126882592 missense probably benign 0.09
R7468:Zmym4 UTSW 4 126882236 missense probably benign 0.40
R7546:Zmym4 UTSW 4 126864168 missense probably damaging 0.99
R7609:Zmym4 UTSW 4 126925795 missense probably benign 0.02
R7764:Zmym4 UTSW 4 126925616 missense probably benign 0.06
R7897:Zmym4 UTSW 4 126889539 missense possibly damaging 0.76
R7980:Zmym4 UTSW 4 126889539 missense possibly damaging 0.76
U24488:Zmym4 UTSW 4 126925660 missense possibly damaging 0.69
Z1177:Zmym4 UTSW 4 126907212 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGCAGTGCCAAGACTAGCAAAC -3'
(R):5'- GAACCCAGAAGTCTTATTCAAGGAGCC -3'

Sequencing Primer
(F):5'- agcactgattgctctgcc -3'
(R):5'- TGCTCAGTGTCTGGAATGAC -3'
Posted On2014-03-28