Mutagenetix > Incidental Mutations

Incidental Mutation 'R1509:Ces4a'

168146

Institutional Source

Beutler Lab

Gene Symbol

Ces4a

Ensembl Gene

ENSMUSG00000060560

Gene Name

carboxylesterase 4A

Synonyms

Ces8

MMRRC Submission

039556-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105131800-105150109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105138097 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 69 (G69S)

Ref Sequence

ENSEMBL: ENSMUSP00000125062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161289]

Predicted Effect

probably damaging
Transcript: ENSMUST00000161289
AA Change: G69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: G69S

Domain	Start	End	E-Value	Type
Pfam:COesterase	8	554	4.9e-163	PFAM
Pfam:Abhydrolase_3	143	319	2e-9	PFAM

Meta Mutation Damage Score

0.7473

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,192,647	S132P	probably benign	Het
4930430A15Rik	A	T	2: 111,218,627	M269K	probably benign	Het
AC153895.1	T	C	6: 50,043,471	R54G	unknown	Het
Acot12	G	A	13: 91,771,875		probably null	Het
Adhfe1	T	A	1: 9,553,446	D98E	probably benign	Het
Ago2	A	G	15: 73,116,364	F594S	probably damaging	Het
Aldh18a1	A	G	19: 40,557,483	I620T	probably damaging	Het
Aspscr1	C	A	11: 120,701,516	A294D	probably damaging	Het
BC067074	A	G	13: 113,368,256	N431S	probably damaging	Het
Bod1l	C	G	5: 41,819,540	R1477T	probably damaging	Het
Ccdc18	C	A	5: 108,188,978	A741D	possibly damaging	Het
Cfap52	C	T	11: 67,938,993	V317I	probably benign	Het
Cgn	A	T	3: 94,774,258	L509Q	probably benign	Het
Crb2	A	G	2: 37,786,619	H204R	probably benign	Het
Ddx39	G	A	8: 83,719,898	V99M	probably damaging	Het
Dis3l2	T	A	1: 87,021,086	C582S	possibly damaging	Het
Dmbt1	G	A	7: 131,074,331		probably benign	Het
Dnah6	T	C	6: 73,027,442	E3846G	probably damaging	Het
Dstyk	A	G	1: 132,456,346	E655G	probably damaging	Het
Epha4	T	C	1: 77,380,886	Y825C	probably damaging	Het
Esp36	T	A	17: 38,417,282	N36I	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fem1c	A	G	18: 46,524,213	S145P	probably benign	Het
Galnt13	T	C	2: 54,733,082	I80T	probably damaging	Het
Gm10125	A	G	18: 5,583,794		noncoding transcript	Het
Gm5698	T	C	1: 30,977,647	T108A	probably benign	Het
Hipk3	A	G	2: 104,441,262	S442P	probably benign	Het
Hmcn2	T	A	2: 31,314,479	V22D	possibly damaging	Het
Hspg2	C	T	4: 137,511,241		probably benign	Het
Ide	A	G	19: 37,285,204		probably null	Het
Ifnar1	C	A	16: 91,503,496	P462Q	probably damaging	Het
Itgb2l	T	A	16: 96,426,849	I485F	probably benign	Het
Jakmip3	C	T	7: 139,027,776	R549W	possibly damaging	Het
Lrrc36	A	G	8: 105,461,129	Q680R	probably damaging	Het
Lysmd3	T	G	13: 81,669,271	H122Q	probably benign	Het
Macf1	C	A	4: 123,684,009	V61L	possibly damaging	Het
Map1b	T	C	13: 99,431,528	T1562A	unknown	Het
Map3k20	A	T	2: 72,364,624		probably benign	Het
Mroh8	A	G	2: 157,233,205	V457A	probably benign	Het
Mrpl40	T	A	16: 18,875,409		probably null	Het
Ms4a10	C	T	19: 10,964,108	V166I	probably benign	Het
Mycl	A	G	4: 123,000,307	D300G	probably damaging	Het
Naca	T	A	10: 128,043,397		probably benign	Het
Ncoa4	T	C	14: 32,173,434	S172P	probably damaging	Het
Nfatc3	T	C	8: 106,083,854	F421L	possibly damaging	Het
Nucb1	C	A	7: 45,495,225	K301N	probably benign	Het
Olfr1451	T	A	19: 12,999,451	I155N	possibly damaging	Het
Olfr366	A	G	2: 37,219,954	H155R	probably damaging	Het
Olfr629	A	T	7: 103,741,036	M68K	probably benign	Het
Panx1	A	T	9: 15,010,045	V178E	possibly damaging	Het
Pkd1l3	G	A	8: 109,640,770	V1210I	probably damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Prdm12	G	A	2: 31,654,174	R263H	probably damaging	Het
Prkdc	A	C	16: 15,731,566	K1998T	probably damaging	Het
Rab11fip1	A	T	8: 27,153,023	S583T	probably damaging	Het
Rnf157	T	A	11: 116,347,095	T567S	probably benign	Het
Rp1	T	C	1: 4,347,694	K1065R	probably damaging	Het
Rp1	A	G	1: 4,348,537	I784T	probably benign	Het
Rps10	A	C	17: 27,631,208	F150V	probably benign	Het
Rrp12	A	T	19: 41,882,200	F499I	probably damaging	Het
Sez6l2	G	A	7: 126,963,363	R604H	probably damaging	Het
Slc25a21	G	T	12: 56,858,079	Q57K	probably benign	Het
Slc27a2	A	G	2: 126,553,314	T54A	possibly damaging	Het
Slc9a9	T	A	9: 95,228,958	S610T	probably benign	Het
Smc1b	A	T	15: 85,086,134	S973T	probably benign	Het
Smc6	G	A	12: 11,279,733	S164N	possibly damaging	Het
Sp1	A	G	15: 102,407,879	T32A	possibly damaging	Het
Spen	T	C	4: 141,475,635	I1894V	probably benign	Het
Spen	T	C	4: 141,475,700	K1872R	possibly damaging	Het
Stab1	C	A	14: 31,151,584		probably benign	Het
Taar7d	T	G	10: 24,028,204	F328C	probably damaging	Het
Ticam1	A	T	17: 56,271,113	S327R	probably benign	Het
Tmem248	C	T	5: 130,229,454		probably benign	Het
Tom1	T	C	8: 75,054,631	S83P	probably damaging	Het
Txk	T	A	5: 72,699,110	Y446F	probably damaging	Het
Ubap1l	T	A	9: 65,371,955	C179S	probably benign	Het
Utrn	T	C	10: 12,455,441	E474G	possibly damaging	Het
Vmn2r14	T	C	5: 109,215,996	M685V	probably benign	Het
Vmn2r7	A	T	3: 64,716,460	Y146*	probably null	Het
Wdr1	G	A	5: 38,540,562	T220M	probably damaging	Het
Xpo7	T	C	14: 70,678,142	D726G	probably damaging	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het
Zbtb3	A	G	19: 8,803,407	D128G	probably damaging	Het
Zfp462	T	A	4: 55,007,667	D35E	probably damaging	Het
Zfp467	A	G	6: 48,438,687	S344P	possibly damaging	Het
Zfpm1	A	T	8: 122,307,546	D73V	possibly damaging	Het

Other mutations in Ces4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Ces4a	APN	8	105145163	missense	probably benign	0.00
IGL01574:Ces4a	APN	8	105145227	splice site	probably benign
IGL01655:Ces4a	APN	8	105147174	missense	probably damaging	0.99
IGL03092:Ces4a	APN	8	105148204	splice site	probably benign
IGL03151:Ces4a	APN	8	105148197	critical splice donor site	probably null
F6893:Ces4a	UTSW	8	105147227	missense	possibly damaging	0.74
R0266:Ces4a	UTSW	8	105141966	missense	probably benign
R0659:Ces4a	UTSW	8	105144922	splice site	probably benign
R1239:Ces4a	UTSW	8	105149498	missense	probably damaging	1.00
R1467:Ces4a	UTSW	8	105138035	missense	possibly damaging	0.56
R1467:Ces4a	UTSW	8	105138035	missense	possibly damaging	0.56
R1505:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1598:Ces4a	UTSW	8	105142821	missense	probably damaging	1.00
R1734:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1736:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1737:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1738:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1744:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1789:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1951:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1953:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2126:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2129:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2202:Ces4a	UTSW	8	105146114	missense	probably damaging	1.00
R4512:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R4865:Ces4a	UTSW	8	105147158	missense	probably benign	0.05
R4934:Ces4a	UTSW	8	105137981	missense	probably benign	0.30
R4936:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R5255:Ces4a	UTSW	8	105142489	missense	probably benign	0.00
R5342:Ces4a	UTSW	8	105146143	missense	probably benign	0.07
R5647:Ces4a	UTSW	8	105146080	missense	probably benign	0.10
R6062:Ces4a	UTSW	8	105138174	critical splice donor site	probably null
R6490:Ces4a	UTSW	8	105149458	missense	probably benign	0.09
R6606:Ces4a	UTSW	8	105149378	missense	possibly damaging	0.95
R6876:Ces4a	UTSW	8	105144992	missense	possibly damaging	0.56
R6901:Ces4a	UTSW	8	105146698	missense	probably benign
R7519:Ces4a	UTSW	8	105145219	missense	probably damaging	1.00
R7682:Ces4a	UTSW	8	105146665	missense	probably benign	0.00
R8171:Ces4a	UTSW	8	105147207	missense	probably damaging	1.00
R8329:Ces4a	UTSW	8	105148082	missense	probably damaging	1.00
R8833:Ces4a	UTSW	8	105131982	missense	probably benign	0.00
Z1176:Ces4a	UTSW	8	105131977	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGATGTACCAGAATCCCATCC -3'
(R):5'- AACCGAAGCCAAGAATAGGTTCCAG -3'

Sequencing Primer
(F):5'- CATGGTTGAGAAGCATAAGAAGAC -3'
(R):5'- CCAAGAATAGGTTCCAGGTTTGC -3'

Posted On

2014-04-13