Incidental Mutation 'R1509:Aldh18a1'
ID168191
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40557483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 620 (I620T)
Ref Sequence ENSEMBL: ENSMUSP00000025979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000175967] [ENSMUST00000176939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025979
AA Change: I620T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: I620T

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155613
Predicted Effect probably benign
Transcript: ENSMUST00000175967
SMART Domains Protein: ENSMUSP00000135419
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:2H5G|B 1 83 9e-52 PDB
SCOP:d1a4sa_ 11 95 1e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176939
AA Change: I618T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: I618T

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Meta Mutation Damage Score 0.8957 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5135:Aldh18a1 UTSW 19 40554817 intron probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40577678 missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACACACATAGAAACGGGCATC -3'
(R):5'- GGTCAGAGACATCCAGAAAGCTGC -3'

Sequencing Primer
(F):5'- CATAGAAACGGGCATCTGTGTATC -3'
(R):5'- TACGTGGATTCCGAAGCCAG -3'
Posted On2014-04-13