Mutagenetix > Incidental Mutations

Incidental Mutation 'R1564:Ripor2'

175143

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik

MMRRC Submission

039603-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R1564 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24582189-24733816 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24675785 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 152 (T152M)

Ref Sequence

ENSEMBL: ENSMUSP00000089286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038477
AA Change: T149M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: T149M

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC
low complexity region	461	476	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000058009
AA Change: T149M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: T149M

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091694
AA Change: T152M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: T152M

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
coiled coil region	111	140	N/A	INTRINSIC
low complexity region	422	437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110383
AA Change: T124M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: T124M

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110384
AA Change: T149M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: T149M

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177298

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	T	C	13: 19,729,300		noncoding transcript	Het
Abca13	C	T	11: 9,434,316	Q3923*	probably null	Het
Abcc12	T	A	8: 86,517,486	T1013S	probably benign	Het
Acad9	T	C	3: 36,089,429	I558T	possibly damaging	Het
Agbl4	C	A	4: 110,955,564		probably null	Het
Akr1b3	C	T	6: 34,306,535		probably null	Het
Aktip	A	G	8: 91,131,081	M1T	probably null	Het
Apc	G	T	18: 34,315,149	Q1665H	probably benign	Het
Arfgef3	T	C	10: 18,591,704	D1916G	probably damaging	Het
Arhgef11	T	C	3: 87,702,510	V365A	probably benign	Het
Bank1	C	A	3: 136,213,841	E265*	probably null	Het
Bbs7	A	T	3: 36,575,795	D578E	probably damaging	Het
Bin3	T	C	14: 70,134,769	F172L	probably damaging	Het
Bves	A	G	10: 45,369,281	D350G	probably benign	Het
Cacna1h	A	T	17: 25,377,861	C80*	probably null	Het
Cacna2d4	T	C	6: 119,241,195	F164L	possibly damaging	Het
Cenpj	T	C	14: 56,552,066	D842G	probably benign	Het
Col12a1	C	A	9: 79,613,840	R2781L	probably damaging	Het
Cyp2c68	A	T	19: 39,735,580	C213*	probably null	Het
Defb33	T	A	8: 20,897,581	C45S	possibly damaging	Het
Dolk	A	T	2: 30,285,621	N137K	probably damaging	Het
Fam171b	G	A	2: 83,880,284	E767K	probably damaging	Het
Fbxl20	A	T	11: 98,098,486	D189E	probably damaging	Het
Gm10643	A	T	8: 84,064,482	M1K	probably null	Het
Gm572	T	G	4: 148,651,186	I24S	possibly damaging	Het
Gnpda1	A	G	18: 38,338,089		probably null	Het
Helz2	G	T	2: 181,233,228	N1824K	probably benign	Het
Insl3	G	T	8: 71,690,291	A99S	possibly damaging	Het
Lpin2	G	A	17: 71,225,060	V137I	probably benign	Het
Lrrc9	A	G	12: 72,487,053	E1032G	probably damaging	Het
Macf1	T	C	4: 123,459,357	T1510A	probably benign	Het
Mnd1	T	C	3: 84,116,431	E116G	probably benign	Het
Mycbp2	A	G	14: 103,169,851		probably null	Het
Myoz3	G	A	18: 60,580,842	S23L	probably benign	Het
Napsa	G	T	7: 44,586,649	V371F	probably damaging	Het
Nefh	T	C	11: 4,939,878	T914A	unknown	Het
Neurod2	A	T	11: 98,327,424	C305S	probably damaging	Het
Nmnat3	T	C	9: 98,354,166		probably null	Het
Nuf2	A	G	1: 169,498,793	V463A	unknown	Het
Olfml1	A	T	7: 107,571,139	T78S	possibly damaging	Het
Olfr1199	A	T	2: 88,756,656	N6K	possibly damaging	Het
Olfr1228	G	T	2: 89,249,672	N7K	probably benign	Het
Olfr61	G	A	7: 140,638,054	V118I	probably benign	Het
Olfr800	T	C	10: 129,660,015	F70L	probably benign	Het
Opcml	G	A	9: 28,903,316	C288Y	probably damaging	Het
Oprl1	T	C	2: 181,718,940	I222T	possibly damaging	Het
Pcsk5	A	G	19: 17,654,756	Y349H	probably damaging	Het
Pla2g4d	C	A	2: 120,268,903	R706L	possibly damaging	Het
Pmm1	A	G	15: 81,956,200	Y55H	probably damaging	Het
Polb	A	G	8: 22,630,341		probably null	Het
Pom121l2	T	C	13: 21,983,353	I598T	possibly damaging	Het
Pxmp2	C	T	5: 110,281,196		probably null	Het
Rbm39	G	T	2: 156,154,257	L403I	probably benign	Het
Rec8	T	C	14: 55,622,275		probably null	Het
Reck	T	C	4: 43,912,061	I190T	probably benign	Het
Rer1	A	T	4: 155,075,593	I166N	probably damaging	Het
Rgs17	T	A	10: 5,842,567	K60*	probably null	Het
Scgb1b2	A	T	7: 31,291,775		probably benign	Het
Scn3a	C	A	2: 65,514,635	R503M	probably damaging	Het
Scn4a	C	A	11: 106,345,541	D298Y	probably benign	Het
Scn9a	A	G	2: 66,484,304	F1679S	probably damaging	Het
Scyl3	G	T	1: 163,939,984		probably null	Het
Sec23ip	A	G	7: 128,766,281		probably null	Het
She	C	T	3: 89,849,614	A325V	possibly damaging	Het
Skint2	T	G	4: 112,625,998	M200R	probably damaging	Het
Slc17a5	A	T	9: 78,578,699	C35S	probably damaging	Het
Slc25a24	T	A	3: 109,163,503	S393T	probably damaging	Het
Slc6a19	C	T	13: 73,686,124	V320M	probably damaging	Het
Snap91	T	C	9: 86,792,196	D579G	possibly damaging	Het
Spats2l	C	T	1: 57,946,224	R479C	probably damaging	Het
Syngr3	G	C	17: 24,686,668		probably null	Het
Tas2r107	A	C	6: 131,659,822	I88R	probably damaging	Het
Them7	A	T	2: 105,297,914	N80I	probably damaging	Het
Tmprss7	C	T	16: 45,662,153		probably null	Het
Tnrc6b	A	G	15: 80,880,168	N624D	possibly damaging	Het
Trpm2	T	G	10: 77,942,999	I378L	probably benign	Het
Ttn	C	A	2: 76,724,532	W30676L	probably damaging	Het
Ttn	A	G	2: 76,944,040	V2220A	unknown	Het
Uba6	T	C	5: 86,154,407	T134A	probably benign	Het
Vmn2r55	A	G	7: 12,684,751	S81P	probably damaging	Het
Zfp616	T	A	11: 74,084,722	S606T	probably damaging	Het
Zfp653	C	A	9: 22,055,859	A577S	probably damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24701207	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24717571	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24695566	splice site	probably benign
IGL02533:Ripor2	APN	13	24701395	nonsense	probably null
IGL02798:Ripor2	APN	13	24674666	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24695698	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24696529	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24723719	missense	probably damaging	1.00
gentleman	UTSW	13	24694145	missense	probably damaging	1.00
Jack	UTSW	13	24677841	nonsense	probably null
whitechapel	UTSW	13	24673112	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24694226	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24680632	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24680644	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24694186	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24677841	nonsense	probably null
R1374:Ripor2	UTSW	13	24673112	critical splice donor site	probably null
R1773:Ripor2	UTSW	13	24701254	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24693887	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24713718	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24721834	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24701612	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24671772	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24706223	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24701627	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24696538	missense	probably benign
R4287:Ripor2	UTSW	13	24725009	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4365:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24694141	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24674666	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24614644	start gained	probably benign
R6157:Ripor2	UTSW	13	24701069	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24710130	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24677845	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24675820	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24706232	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24671846	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24693766	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24704825	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24671903	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24694145	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24701444	nonsense	probably null
R7417:Ripor2	UTSW	13	24696550	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24694205	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24670071	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24696307	missense	unknown
R7499:Ripor2	UTSW	13	24693772	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTCCACCAGACATCAGATGGAC -3'
(R):5'- CCAACCGTGCCAGTTAATCAGACTC -3'

Sequencing Primer
(F):5'- AGTTCAAGCTCATCTCTCAGG -3'
(R):5'- gccatttctccagcccc -3'

Posted On

2014-04-24