Incidental Mutation 'R4287:Ripor2'
ID322073
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24725009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1037 (V1037M)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110383] [ENSMUST00000110384]
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: V1012M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: V1012M

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: V1037M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: V1037M

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAACCAATTCTTCACCCG -3'
(R):5'- GTGCAAGATCTGGACACAATCG -3'

Sequencing Primer
(F):5'- GTTGTTTCAATCCAAGCACAAGAG -3'
(R):5'- GCAAGATCTGGACACAATCGATTTC -3'
Posted On2015-06-20