Mutagenetix > Incidental Mutation

Incidental Mutation 'R7448:Ripor2'

577501

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik

MMRRC Submission

045523-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.223) question?

Stock #

R7448 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24582189-24733816 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24670071 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 54 (Q54L)

Ref Sequence

ENSEMBL: ENSMUSP00000106013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]

AlphaFold

Q80U16

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038477
AA Change: Q54L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: Q54L

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC
low complexity region	461	476	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058009
AA Change: Q54L

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: Q54L

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091694
AA Change: Q57L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: Q57L

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
coiled coil region	111	140	N/A	INTRINSIC
low complexity region	422	437	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110383
AA Change: Q29L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: Q29L

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110384
AA Change: Q54L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: Q54L

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132689

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (117/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,257,266	N256D	probably damaging	Het
1700015F17Rik	T	C	5: 5,455,952	I110V	probably benign	Het
Acss2	T	C	2: 155,518,266	S54P	probably damaging	Het
Ahnak2	T	C	12: 112,782,502	K1242E		Het
Alpi	T	A	1: 87,101,535	M1L	possibly damaging	Het
Atp2c1	C	T	9: 105,452,783	A283T	probably damaging	Het
Atp8b5	T	G	4: 43,366,021	M764R	probably benign	Het
B4galnt2	T	A	11: 95,869,367	H278L	probably damaging	Het
Bcl9l	G	T	9: 44,509,337	A1347S	probably benign	Het
Bicd2	A	G	13: 49,379,951	E671G	probably damaging	Het
Bmp3	A	T	5: 98,872,218	I167F	probably damaging	Het
Bpifb5	T	A	2: 154,230,185	C271S	possibly damaging	Het
Camsap2	T	A	1: 136,270,906	H793L		Het
Casp8ap2	T	A	4: 32,643,974	S1016T	possibly damaging	Het
Ccdc134	T	A	15: 82,140,948	I216N	possibly damaging	Het
Ccdc63	G	T	5: 122,108,182	R559S	probably benign	Het
Cd276	T	C	9: 58,535,612	T187A	probably benign	Het
Ciao1	C	T	2: 127,245,758	R219H	probably damaging	Het
Clmn	T	C	12: 104,785,428	D256G	possibly damaging	Het
Cobl	A	C	11: 12,256,225	M550R	possibly damaging	Het
Cracr2b	A	T	7: 141,464,205	T117S	probably benign	Het
Cx3cr1	G	A	9: 120,052,216	A40V	probably benign	Het
Cxcl14	A	G	13: 56,292,531	C72R	probably damaging	Het
Dab2	T	A	15: 6,422,266	I121N	probably damaging	Het
Dapk1	A	G	13: 60,751,176	Y820C	probably damaging	Het
Ech1	T	A	7: 28,826,198	C91S	probably damaging	Het
Exosc5	T	G	7: 25,659,309	V25G	probably benign	Het
Fam160a1	G	A	3: 85,672,564	S778L	probably benign	Het
Fbp1	A	C	13: 62,872,750	D122E	possibly damaging	Het
Fbxw13	A	G	9: 109,185,403	Y101H	unknown	Het
Fmnl1	T	A	11: 103,186,627	V271E	probably damaging	Het
Fuk	C	T	8: 110,890,331	G396S	possibly damaging	Het
Galnt1	T	A	18: 24,284,809	S545T	probably benign	Het
Galnt13	G	A	2: 54,516,564	V9M	possibly damaging	Het
Gatsl3	A	G	11: 4,221,897	S325G	not run	Het
Gm3550	A	G	18: 34,737,527	K38R	probably damaging	Het
Gm7995	A	T	14: 42,310,345	I45F		Het
Gpr137	C	T	19: 6,940,358	R134Q	possibly damaging	Het
Gpr22	T	G	12: 31,709,515	I203L	probably benign	Het
H2-Q10	T	C	17: 35,473,560	Y324H	not run	Het
Hcn4	G	A	9: 58,844,299	E403K	unknown	Het
Hddc2	T	A	10: 31,313,416	M1K	probably null	Het
Hps3	A	G	3: 20,035,165	F34S	probably damaging	Het
Igdcc4	G	T	9: 65,123,994	V405L	possibly damaging	Het
Itpr2	C	A	6: 146,329,508	V1215L	probably damaging	Het
Kif26b	T	C	1: 178,914,774	S812P	probably damaging	Het
Lgi1	T	A	19: 38,301,265	C260S	probably damaging	Het
Lhfp	A	G	3: 53,260,599	Y198C	probably damaging	Het
Lrp5	T	C	19: 3,649,439	D282G	probably benign	Het
Lrpprc	T	C	17: 84,772,139	T230A	probably damaging	Het
Lrtm2	A	G	6: 119,320,823	W86R	probably benign	Het
Magi2	G	A	5: 20,358,956	G199D	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
March7	T	A	2: 60,247,514		probably null	Het
Morc1	A	G	16: 48,431,345	D2G	probably damaging	Het
Mpp7	A	T	18: 7,351,079	F539L	probably damaging	Het
Muc13	A	T	16: 33,814,581	I502F	probably damaging	Het
Myh13	A	G	11: 67,364,460		probably null	Het
Nat10	C	G	2: 103,748,045	L238F	probably damaging	Het
Nckap1	G	A	2: 80,524,541	T679I	probably damaging	Het
Npy6r	T	A	18: 44,276,193	I227N	probably damaging	Het
Nudt18	A	T	14: 70,577,949	M1L	unknown	Het
Olfr1306	T	A	2: 111,912,292	I213L	probably benign	Het
Olfr26	C	A	9: 38,855,116	T18K	probably damaging	Het
Olfr270	T	A	4: 52,971,207	N195K	probably damaging	Het
Olfr298	G	A	7: 86,489,209	T114I	probably damaging	Het
Olfr52	T	C	2: 86,181,334	Y259C	probably damaging	Het
Pcdha3	T	A	18: 36,946,213	F3I	probably benign	Het
Pcdhga3	T	A	18: 37,675,864	Y457N	possibly damaging	Het
Pclo	A	T	5: 14,669,617	Q1256L	unknown	Het
Piezo2	C	T	18: 63,024,472	R2389H	probably damaging	Het
Pml	G	T	9: 58,247,213	Q126K	probably benign	Het
Ppef2	A	G	5: 92,228,704	Y655H	probably damaging	Het
Ppp4r1	T	C	17: 65,840,941	V926A	probably damaging	Het
Psg29	A	G	7: 17,211,723	D406G	possibly damaging	Het
Ptprf	T	C	4: 118,235,667	D517G	probably benign	Het
Ptprg	G	A	14: 12,142,461	E371K	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rasgrp1	T	A	2: 117,291,697	D404V	possibly damaging	Het
Rb1cc1	T	A	1: 6,245,503	F541I	probably damaging	Het
Rgsl1	C	A	1: 153,844,101		probably null	Het
Rhobtb2	C	T	14: 69,795,948	W524*	probably null	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rims1	A	G	1: 22,404,475	S211P		Het
Rnf213	A	G	11: 119,481,291	I4903V		Het
Robo3	T	A	9: 37,424,815	I452F	possibly damaging	Het
Seh1l	C	T	18: 67,783,918	H56Y	probably damaging	Het
Sema3b	T	A	9: 107,602,963	D192V	probably damaging	Het
Sidt1	A	T	16: 44,286,400	C222*	probably null	Het
Skor1	A	G	9: 63,146,103	F195L	probably damaging	Het
Slc44a2	A	C	9: 21,348,346	K596N	possibly damaging	Het
Smgc	A	G	15: 91,845,493	K217E	probably benign	Het
Socs7	C	A	11: 97,377,091	H349Q	possibly damaging	Het
Speer4f2	A	G	5: 17,376,542	T161A		Het
Spg11	T	C	2: 122,093,545		probably null	Het
Ssb	A	G	2: 69,863,280	T11A	probably benign	Het
Sun1	A	G	5: 139,246,834	S837G	probably damaging	Het
Szt2	A	C	4: 118,363,471	S3385A	unknown	Het
Tapbp	T	C	17: 33,920,417	V129A	possibly damaging	Het
Thsd1	T	C	8: 22,243,333	I132T	possibly damaging	Het
Tm6sf2	T	A	8: 70,077,939	V223E	possibly damaging	Het
Tm9sf4	T	A	2: 153,194,347	M343K	probably benign	Het
Tmem57	A	T	4: 134,828,279	N294K	possibly damaging	Het
Trank1	C	A	9: 111,366,349	P1147Q	probably benign	Het
Trip4	G	A	9: 65,866,475	T275M	probably damaging	Het
Tsen34	T	C	7: 3,695,835		probably null	Het
Ttc26	T	A	6: 38,404,487	Y319*	probably null	Het
Ttn	T	C	2: 76,850,078	E1086G	unknown	Het
Ubr4	A	T	4: 139,462,467	M853L	unknown	Het
Ubxn11	A	T	4: 134,125,155	R352W	probably damaging	Het
Vmn1r35	G	A	6: 66,679,235		probably benign	Het
Vmn2r107	C	T	17: 20,375,732	T849I	probably benign	Het
Vmn2r93	C	A	17: 18,325,986	L707I	probably benign	Het
Wwc1	G	A	11: 35,875,706	T574I	probably benign	Het
Zfp143	A	G	7: 110,070,498	M45V	probably benign	Het
Zfp518a	T	A	19: 40,914,157	N843K	possibly damaging	Het
Zfp87	A	T	13: 67,517,044	M433K	probably benign	Het
Zfp873	C	A	10: 82,060,627	H397Q	probably damaging	Het
Zscan21	A	T	5: 138,117,848		probably benign	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24701207	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24717571	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24695566	splice site	probably benign
IGL02533:Ripor2	APN	13	24701395	nonsense	probably null
IGL02798:Ripor2	APN	13	24674666	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24695698	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24696529	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24723719	missense	probably damaging	1.00
gentleman	UTSW	13	24694145	missense	probably damaging	1.00
Jack	UTSW	13	24677841	nonsense	probably null
whitechapel	UTSW	13	24673112	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24694226	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24680632	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24680644	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24694186	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24677841	nonsense	probably null
R1374:Ripor2	UTSW	13	24673112	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24675785	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24701254	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24693887	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24713718	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24721834	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24701612	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24671772	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24706223	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24701627	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24696538	missense	probably benign
R4287:Ripor2	UTSW	13	24725009	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4365:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24694141	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24674666	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24614644	start gained	probably benign
R6157:Ripor2	UTSW	13	24701069	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24710130	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24677845	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24675820	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24706232	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24671846	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24693766	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24704825	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24671903	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24694145	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24701444	nonsense	probably null
R7417:Ripor2	UTSW	13	24696550	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24694205	missense	probably benign	0.01
R7462:Ripor2	UTSW	13	24696307	missense	unknown
R7499:Ripor2	UTSW	13	24693772	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24713700	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24695617	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24710193	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24723788	missense	probably damaging	1.00
R8465:Ripor2	UTSW	13	24665468	intron	probably benign
R8751:Ripor2	UTSW	13	24701067	missense	possibly damaging	0.69
R8818:Ripor2	UTSW	13	24717668	missense	possibly damaging	0.93
R8867:Ripor2	UTSW	13	24638777	intron	probably benign
R9079:Ripor2	UTSW	13	24731654	missense	probably benign	0.35
R9187:Ripor2	UTSW	13	24713649	missense	probably benign	0.01
R9316:Ripor2	UTSW	13	24721736	missense	probably benign	0.09
R9320:Ripor2	UTSW	13	24731680	missense	probably damaging	1.00
R9355:Ripor2	UTSW	13	24701711	missense	probably benign	0.00
R9655:Ripor2	UTSW	13	24725000	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TCACGCCCCTGAATATTGAC -3'
(R):5'- GCCAGATGTGTATGCATACTTG -3'

Sequencing Primer
(F):5'- CTGAATATTGACAAGCCTGACAGTC -3'
(R):5'- CCAGATGTGTATGCATACTTGTGTAC -3'

Posted On

2019-10-07