Incidental Mutation 'R1600:Grk1'
ID176095
Institutional Source Beutler Lab
Gene Symbol Grk1
Ensembl Gene ENSMUSG00000031450
Gene NameG protein-coupled receptor kinase 1
SynonymsRK, Rhok
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13405081-13421951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13405406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000147484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033827] [ENSMUST00000209909]
Predicted Effect probably benign
Transcript: ENSMUST00000033827
AA Change: T97A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000033827
Gene: ENSMUSG00000031450
AA Change: T97A

DomainStartEndE-ValueType
RGS 57 175 7.34e-35 SMART
S_TKc 190 455 3.42e-81 SMART
S_TK_X 456 535 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209909
AA Change: T97A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211027
Meta Mutation Damage Score 0.1419 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Analysis of homozygous null mice revealed abnormal photoresponses and light-induced apoptosis in rods. Mutant mice may serve as models of Oguchi disease and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Grk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Grk1 APN 8 13413128 nonsense probably null
IGL00501:Grk1 APN 8 13407835 missense probably damaging 1.00
IGL00772:Grk1 APN 8 13405349 missense probably benign
IGL00905:Grk1 APN 8 13416068 missense probably benign 0.32
IGL01116:Grk1 APN 8 13405404 missense possibly damaging 0.52
IGL01976:Grk1 APN 8 13415993 missense probably damaging 1.00
R0463:Grk1 UTSW 8 13409279 missense probably damaging 1.00
R1838:Grk1 UTSW 8 13416155 missense possibly damaging 0.77
R1911:Grk1 UTSW 8 13407923 missense probably damaging 0.99
R2122:Grk1 UTSW 8 13405221 missense probably benign 0.01
R4583:Grk1 UTSW 8 13409322 missense probably damaging 0.99
R5347:Grk1 UTSW 8 13414478 missense probably damaging 1.00
R5520:Grk1 UTSW 8 13409305 missense probably benign
R5682:Grk1 UTSW 8 13414351 missense possibly damaging 0.88
R6145:Grk1 UTSW 8 13405765 nonsense probably null
R6329:Grk1 UTSW 8 13405704 missense probably damaging 1.00
R6415:Grk1 UTSW 8 13413127 missense probably damaging 1.00
R6717:Grk1 UTSW 8 13416237 missense probably benign 0.01
R7421:Grk1 UTSW 8 13405316 missense probably damaging 1.00
R8401:Grk1 UTSW 8 13407846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTTGACGGAAGCAGCACAC -3'
(R):5'- TCATCTGACAGGCAGACACTTCCC -3'

Sequencing Primer
(F):5'- GTCTTCCCGAGACAAGAAATATCTG -3'
(R):5'- CAAGTGCTCCATTGTGGC -3'
Posted On2014-04-24