Incidental Mutation 'R1668:Sptb'
ID187396
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R1668 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76621169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 718 (V718A)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably benign
Transcript: ENSMUST00000021458
AA Change: V718A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: V718A

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166101
AA Change: V718A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: V718A

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7846:Sptb UTSW 12 76608526 nonsense probably null
R7929:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TACATCTTCACCAGAGAGCAGCCG -3'
(R):5'- CACCTAGAGCAGTGCTTCAGTGAAC -3'

Sequencing Primer
(F):5'- GGTGAGCGTCTTGCAGC -3'
(R):5'- AGTCTAAGCGACTCTGGAAGTTC -3'
Posted On2014-05-09