Incidental Mutation 'R1753:Cacna2d1'
ID193721
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 039785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R1753 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16302354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 367 (E367G)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039370
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078272
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101581
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115281
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167946
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180204
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199704
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,973,716 F409I probably benign Het
Adamts19 A C 18: 59,007,372 I848L possibly damaging Het
Adamts5 T C 16: 85,899,352 S306G probably damaging Het
Adamts8 T G 9: 30,954,614 I486S probably benign Het
Adgrg5 T C 8: 94,942,052 F499L possibly damaging Het
Akr1c21 T A 13: 4,577,135 C145* probably null Het
Anp32b T G 4: 46,460,241 probably null Het
Arhgap31 A G 16: 38,601,612 V1364A possibly damaging Het
C2cd6 T C 1: 59,094,833 R10G possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cd2 A T 3: 101,287,499 M91K possibly damaging Het
Cdc16 C A 8: 13,764,688 Y157* probably null Het
Celsr3 G T 9: 108,831,857 V1301F probably damaging Het
Cep164 C T 9: 45,792,937 G961S probably damaging Het
Cep290 T C 10: 100,513,981 V630A probably benign Het
Chd5 C T 4: 152,378,815 S1451F probably damaging Het
Cldn23 A C 8: 35,825,986 L116R possibly damaging Het
Cngb1 A T 8: 95,297,773 probably benign Het
Cpb1 G T 3: 20,266,241 N151K possibly damaging Het
Cpn2 A G 16: 30,260,100 F261S probably damaging Het
Crlf3 A C 11: 80,057,872 V249G probably damaging Het
Csmd1 A T 8: 16,157,120 Y1298* probably null Het
Cstf2t C A 19: 31,083,685 P207Q possibly damaging Het
Cym A C 3: 107,213,425 L288R possibly damaging Het
Cyp2j12 C T 4: 96,121,432 probably null Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnmt3a A T 12: 3,873,342 M181L possibly damaging Het
Duox1 T A 2: 122,333,429 M859K probably damaging Het
Eif2b4 A T 5: 31,192,940 S13T probably benign Het
Ercc6 T C 14: 32,576,999 V1448A probably benign Het
Esp24 A G 17: 39,040,002 E31G possibly damaging Het
F2rl2 T A 13: 95,701,461 M338K probably benign Het
Fgfbp1 A C 5: 43,979,923 L9R possibly damaging Het
Gal3st2b A T 1: 93,940,616 N188Y probably damaging Het
Gpr179 G C 11: 97,346,578 C372W probably damaging Het
Grn T G 11: 102,433,267 C61G probably damaging Het
Herc1 T G 9: 66,469,010 C3371G probably damaging Het
Herc1 T C 9: 66,502,084 probably null Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ifi35 A T 11: 101,456,635 R31W probably damaging Het
Ifit1bl1 T A 19: 34,593,860 H399L probably benign Het
Irx3 G A 8: 91,800,734 P114L probably damaging Het
Kat6a T A 8: 22,935,797 D1119E probably benign Het
Kmt2d G T 15: 98,843,482 probably benign Het
Kng1 A T 16: 23,079,119 H423L possibly damaging Het
Lrp2 T A 2: 69,496,489 Q1746L possibly damaging Het
Lrrc29 A T 8: 105,313,192 V517E probably damaging Het
Lrrc63 A T 14: 75,086,344 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Map3k19 A G 1: 127,822,680 M978T probably benign Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Mpo A G 11: 87,795,881 N85D probably benign Het
Mpp4 T C 1: 59,144,810 D244G probably null Het
Mstn A G 1: 53,066,558 Y353C probably damaging Het
Mx1 T A 16: 97,454,158 N232Y probably damaging Het
Mycs T C X: 5,468,103 R308G probably benign Het
Myh11 A T 16: 14,277,870 D9E probably benign Het
Nfe2l3 A T 6: 51,433,412 Q169L probably null Het
Nr5a1 G T 2: 38,708,419 T122N possibly damaging Het
Nras A G 3: 103,058,979 T20A probably damaging Het
Obp2b T A 2: 25,738,640 probably null Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr1143 T A 2: 87,802,762 F124L probably benign Het
Olfr1410 G A 1: 92,608,400 V188M probably benign Het
Olfr365 A G 2: 37,201,427 Y62C probably damaging Het
Olfr577 T C 7: 102,973,056 N312S probably benign Het
Pcdh17 A T 14: 84,477,654 T920S probably benign Het
Pcdh9 T C 14: 93,887,225 D503G probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pde6b C A 5: 108,388,691 C84* probably null Het
Pex1 A T 5: 3,630,044 N914I probably damaging Het
Pign A G 1: 105,589,317 V528A possibly damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Ppip5k1 T C 2: 121,342,631 K489E probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Radil T C 5: 142,495,336 Y572C probably damaging Het
Rapgef2 A G 3: 79,088,791 I555T possibly damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
Rnaset2b G A 17: 6,981,107 probably null Het
S1pr1 A G 3: 115,711,938 S336P probably benign Het
Slc24a5 A G 2: 125,083,195 E252G possibly damaging Het
Slc34a2 A T 5: 53,061,391 I184F probably benign Het
Slc35a3 A G 3: 116,677,948 V224A possibly damaging Het
Slc39a9 A G 12: 80,677,202 H211R probably damaging Het
Slu7 A G 11: 43,439,268 N174S probably benign Het
Smarcd3 A T 5: 24,595,822 Y131* probably null Het
Syne1 A G 10: 5,367,621 M491T probably benign Het
Tars G A 15: 11,394,243 Q103* probably null Het
Tmem132d C A 5: 127,789,855 E660D probably benign Het
Ttn T A 2: 76,752,261 M22763L probably benign Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ubp1 A T 9: 113,955,969 I117L possibly damaging Het
Usp24 T A 4: 106,377,559 H954Q probably benign Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r63 G A 7: 42,928,245 Q290* probably null Het
Vnn3 T C 10: 23,865,820 I341T probably benign Het
Wbp2nl A G 15: 82,305,744 T46A probably damaging Het
Wdr48 G T 9: 119,924,247 E625* probably null Het
Wdr6 C T 9: 108,575,164 V507I probably damaging Het
Zp2 A T 7: 120,138,105 W287R probably benign Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 splice site probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 splice site probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
R7608:Cacna2d1 UTSW 5 16359024 missense probably damaging 1.00
R7712:Cacna2d1 UTSW 5 16362349 missense probably damaging 0.98
R8014:Cacna2d1 UTSW 5 16342691 missense possibly damaging 0.55
R8161:Cacna2d1 UTSW 5 16314937 missense probably damaging 1.00
RF024:Cacna2d1 UTSW 5 16025776 missense possibly damaging 0.80
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTACCCCTTGCCTGATCATCAAAC -3'
(R):5'- TGCCCATGAAGTGCTGCAAACC -3'

Sequencing Primer
(F):5'- TTTTAGAACACACTACTGAGCAGAC -3'
(R):5'- TGATTAGGAGACATCGCTCAC -3'
Posted On2014-05-23