Incidental Mutation 'R1753:Cacna2d1'
ID 193721
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms Cchl2a, Cacna2, Ca(v)alpha2delta1
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.302) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 16139689-16579509 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16507352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 367 (E367G)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
AlphaFold O08532
Predicted Effect possibly damaging
Transcript: ENSMUST00000039370
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078272
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101581
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115281
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167946
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180204
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199704
AA Change: E367G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: E367G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16,417,942 (GRCm39) missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16,451,654 (GRCm39) splice site probably benign
IGL00495:Cacna2d1 APN 5 16,575,607 (GRCm39) missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16,451,783 (GRCm39) nonsense probably null
IGL00990:Cacna2d1 APN 5 16,140,067 (GRCm39) missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16,575,646 (GRCm39) missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16,575,629 (GRCm39) missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16,531,390 (GRCm39) splice site probably benign
IGL01645:Cacna2d1 APN 5 16,217,389 (GRCm39) splice site probably null
IGL01959:Cacna2d1 APN 5 16,417,895 (GRCm39) missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16,525,162 (GRCm39) splice site probably benign
IGL03152:Cacna2d1 APN 5 16,527,566 (GRCm39) missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16,558,840 (GRCm39) missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16,561,821 (GRCm39) missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16,507,292 (GRCm39) missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16,531,342 (GRCm39) missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16,566,815 (GRCm39) splice site probably benign
R0457:Cacna2d1 UTSW 5 16,472,414 (GRCm39) missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16,399,796 (GRCm39) critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16,564,025 (GRCm39) missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16,567,271 (GRCm39) missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16,533,041 (GRCm39) missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16,570,860 (GRCm39) missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16,570,860 (GRCm39) missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16,527,595 (GRCm39) critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16,566,874 (GRCm39) critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16,562,764 (GRCm39) missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16,560,493 (GRCm39) missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16,471,716 (GRCm39) missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16,575,625 (GRCm39) missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16,525,114 (GRCm39) missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16,504,988 (GRCm39) missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16,469,286 (GRCm39) missense probably benign 0.01
R1966:Cacna2d1 UTSW 5 16,538,783 (GRCm39) nonsense probably null
R2163:Cacna2d1 UTSW 5 16,567,317 (GRCm39) missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16,562,287 (GRCm39) missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16,517,566 (GRCm39) missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16,517,566 (GRCm39) missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16,507,246 (GRCm39) splice site probably null
R4804:Cacna2d1 UTSW 5 16,564,206 (GRCm39) missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16,564,068 (GRCm39) missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16,567,394 (GRCm39) critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16,451,712 (GRCm39) missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16,557,676 (GRCm39) missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16,517,517 (GRCm39) missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16,507,333 (GRCm39) missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16,563,950 (GRCm39) missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 16,140,037 (GRCm39) nonsense probably null
R6005:Cacna2d1 UTSW 5 16,566,819 (GRCm39) missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16,527,562 (GRCm39) missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16,559,655 (GRCm39) missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16,524,448 (GRCm39) splice site probably null
R6625:Cacna2d1 UTSW 5 16,567,391 (GRCm39) missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16,570,458 (GRCm39) missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16,531,338 (GRCm39) missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16,505,039 (GRCm39) missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16,557,666 (GRCm39) nonsense probably null
R7035:Cacna2d1 UTSW 5 16,451,670 (GRCm39) missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16,554,414 (GRCm39) missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16,562,782 (GRCm39) missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16,575,586 (GRCm39) missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16,519,914 (GRCm39) missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 16,139,973 (GRCm39) start gained probably benign
R7608:Cacna2d1 UTSW 5 16,564,022 (GRCm39) missense probably damaging 1.00
R7712:Cacna2d1 UTSW 5 16,567,347 (GRCm39) missense probably damaging 0.98
R8014:Cacna2d1 UTSW 5 16,547,689 (GRCm39) missense possibly damaging 0.55
R8161:Cacna2d1 UTSW 5 16,519,935 (GRCm39) missense probably damaging 1.00
R8669:Cacna2d1 UTSW 5 16,140,013 (GRCm39) start codon destroyed probably null 0.53
R8670:Cacna2d1 UTSW 5 16,140,013 (GRCm39) start codon destroyed probably null 0.53
R8682:Cacna2d1 UTSW 5 16,558,837 (GRCm39) missense possibly damaging 0.95
R8697:Cacna2d1 UTSW 5 16,570,865 (GRCm39) missense possibly damaging 0.89
R8807:Cacna2d1 UTSW 5 16,472,452 (GRCm39) missense probably damaging 1.00
R8834:Cacna2d1 UTSW 5 16,471,735 (GRCm39) missense possibly damaging 0.79
R9135:Cacna2d1 UTSW 5 16,558,850 (GRCm39) missense probably damaging 1.00
R9158:Cacna2d1 UTSW 5 16,140,039 (GRCm39) missense probably benign
R9169:Cacna2d1 UTSW 5 16,451,757 (GRCm39) missense probably damaging 1.00
R9294:Cacna2d1 UTSW 5 16,217,396 (GRCm39) missense probably damaging 0.97
R9296:Cacna2d1 UTSW 5 16,564,068 (GRCm39) missense probably damaging 1.00
R9393:Cacna2d1 UTSW 5 16,140,013 (GRCm39) start codon destroyed probably null 0.53
R9394:Cacna2d1 UTSW 5 16,140,013 (GRCm39) start codon destroyed probably null 0.53
R9395:Cacna2d1 UTSW 5 16,140,013 (GRCm39) start codon destroyed probably null 0.53
R9484:Cacna2d1 UTSW 5 16,561,831 (GRCm39) missense probably damaging 1.00
RF024:Cacna2d1 UTSW 5 16,230,774 (GRCm39) missense possibly damaging 0.80
Z1088:Cacna2d1 UTSW 5 16,399,761 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTACCCCTTGCCTGATCATCAAAC -3'
(R):5'- TGCCCATGAAGTGCTGCAAACC -3'

Sequencing Primer
(F):5'- TTTTAGAACACACTACTGAGCAGAC -3'
(R):5'- TGATTAGGAGACATCGCTCAC -3'
Posted On 2014-05-23