Incidental Mutation 'R1753:Cep164'
ID193752
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission 039785-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1753 (G1)
Quality Score167
Status Not validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45792937 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 961 (G961S)
Ref Sequence ENSEMBL: ENSMUSP00000149815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284] [ENSMUST00000217554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117194
AA Change: G408S

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: G408S

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132430
AA Change: G186S
SMART Domains Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: G186S

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
coiled coil region 325 612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213154
AA Change: G961S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215216
Predicted Effect probably benign
Transcript: ENSMUST00000216284
AA Change: G248S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217022
Predicted Effect probably benign
Transcript: ENSMUST00000217554
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,973,716 F409I probably benign Het
Adamts19 A C 18: 59,007,372 I848L possibly damaging Het
Adamts5 T C 16: 85,899,352 S306G probably damaging Het
Adamts8 T G 9: 30,954,614 I486S probably benign Het
Adgrg5 T C 8: 94,942,052 F499L possibly damaging Het
Akr1c21 T A 13: 4,577,135 C145* probably null Het
Anp32b T G 4: 46,460,241 probably null Het
Arhgap31 A G 16: 38,601,612 V1364A possibly damaging Het
C2cd6 T C 1: 59,094,833 R10G possibly damaging Het
Cacna2d1 A G 5: 16,302,354 E367G possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cd2 A T 3: 101,287,499 M91K possibly damaging Het
Cdc16 C A 8: 13,764,688 Y157* probably null Het
Celsr3 G T 9: 108,831,857 V1301F probably damaging Het
Cep290 T C 10: 100,513,981 V630A probably benign Het
Chd5 C T 4: 152,378,815 S1451F probably damaging Het
Cldn23 A C 8: 35,825,986 L116R possibly damaging Het
Cngb1 A T 8: 95,297,773 probably benign Het
Cpb1 G T 3: 20,266,241 N151K possibly damaging Het
Cpn2 A G 16: 30,260,100 F261S probably damaging Het
Crlf3 A C 11: 80,057,872 V249G probably damaging Het
Csmd1 A T 8: 16,157,120 Y1298* probably null Het
Cstf2t C A 19: 31,083,685 P207Q possibly damaging Het
Cym A C 3: 107,213,425 L288R possibly damaging Het
Cyp2j12 C T 4: 96,121,432 probably null Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnmt3a A T 12: 3,873,342 M181L possibly damaging Het
Duox1 T A 2: 122,333,429 M859K probably damaging Het
Eif2b4 A T 5: 31,192,940 S13T probably benign Het
Ercc6 T C 14: 32,576,999 V1448A probably benign Het
Esp24 A G 17: 39,040,002 E31G possibly damaging Het
F2rl2 T A 13: 95,701,461 M338K probably benign Het
Fgfbp1 A C 5: 43,979,923 L9R possibly damaging Het
Gal3st2b A T 1: 93,940,616 N188Y probably damaging Het
Gpr179 G C 11: 97,346,578 C372W probably damaging Het
Grn T G 11: 102,433,267 C61G probably damaging Het
Herc1 T G 9: 66,469,010 C3371G probably damaging Het
Herc1 T C 9: 66,502,084 probably null Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ifi35 A T 11: 101,456,635 R31W probably damaging Het
Ifit1bl1 T A 19: 34,593,860 H399L probably benign Het
Irx3 G A 8: 91,800,734 P114L probably damaging Het
Kat6a T A 8: 22,935,797 D1119E probably benign Het
Kmt2d G T 15: 98,843,482 probably benign Het
Kng1 A T 16: 23,079,119 H423L possibly damaging Het
Lrp2 T A 2: 69,496,489 Q1746L possibly damaging Het
Lrrc29 A T 8: 105,313,192 V517E probably damaging Het
Lrrc63 A T 14: 75,086,344 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Map3k19 A G 1: 127,822,680 M978T probably benign Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Mpo A G 11: 87,795,881 N85D probably benign Het
Mpp4 T C 1: 59,144,810 D244G probably null Het
Mstn A G 1: 53,066,558 Y353C probably damaging Het
Mx1 T A 16: 97,454,158 N232Y probably damaging Het
Mycs T C X: 5,468,103 R308G probably benign Het
Myh11 A T 16: 14,277,870 D9E probably benign Het
Nfe2l3 A T 6: 51,433,412 Q169L probably null Het
Nr5a1 G T 2: 38,708,419 T122N possibly damaging Het
Nras A G 3: 103,058,979 T20A probably damaging Het
Obp2b T A 2: 25,738,640 probably null Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr1143 T A 2: 87,802,762 F124L probably benign Het
Olfr1410 G A 1: 92,608,400 V188M probably benign Het
Olfr365 A G 2: 37,201,427 Y62C probably damaging Het
Olfr577 T C 7: 102,973,056 N312S probably benign Het
Pcdh17 A T 14: 84,477,654 T920S probably benign Het
Pcdh9 T C 14: 93,887,225 D503G probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pde6b C A 5: 108,388,691 C84* probably null Het
Pex1 A T 5: 3,630,044 N914I probably damaging Het
Pign A G 1: 105,589,317 V528A possibly damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Ppip5k1 T C 2: 121,342,631 K489E probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Radil T C 5: 142,495,336 Y572C probably damaging Het
Rapgef2 A G 3: 79,088,791 I555T possibly damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
Rnaset2b G A 17: 6,981,107 probably null Het
S1pr1 A G 3: 115,711,938 S336P probably benign Het
Slc24a5 A G 2: 125,083,195 E252G possibly damaging Het
Slc34a2 A T 5: 53,061,391 I184F probably benign Het
Slc35a3 A G 3: 116,677,948 V224A possibly damaging Het
Slc39a9 A G 12: 80,677,202 H211R probably damaging Het
Slu7 A G 11: 43,439,268 N174S probably benign Het
Smarcd3 A T 5: 24,595,822 Y131* probably null Het
Syne1 A G 10: 5,367,621 M491T probably benign Het
Tars G A 15: 11,394,243 Q103* probably null Het
Tmem132d C A 5: 127,789,855 E660D probably benign Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T A 2: 76,752,261 M22763L probably benign Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Ubp1 A T 9: 113,955,969 I117L possibly damaging Het
Usp24 T A 4: 106,377,559 H954Q probably benign Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r63 G A 7: 42,928,245 Q290* probably null Het
Vnn3 T C 10: 23,865,820 I341T probably benign Het
Wbp2nl A G 15: 82,305,744 T46A probably damaging Het
Wdr48 G T 9: 119,924,247 E625* probably null Het
Wdr6 C T 9: 108,575,164 V507I probably damaging Het
Zp2 A T 7: 120,138,105 W287R probably benign Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1445:Cep164 UTSW 9 45778900 missense possibly damaging 0.66
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2186:Cep164 UTSW 9 45768578 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R4424:Cep164 UTSW 9 45779704 missense possibly damaging 0.92
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R5997:Cep164 UTSW 9 45769463 missense possibly damaging 0.92
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
R7310:Cep164 UTSW 9 45775366 missense probably damaging 1.00
R7420:Cep164 UTSW 9 45768542 missense probably benign 0.01
R7651:Cep164 UTSW 9 45773852 missense probably benign 0.18
R7918:Cep164 UTSW 9 45779688 critical splice donor site probably null
R7982:Cep164 UTSW 9 45778864 missense probably benign 0.40
R8010:Cep164 UTSW 9 45823671 missense unknown
R8391:Cep164 UTSW 9 45807193 missense unknown
R8553:Cep164 UTSW 9 45807210 unclassified probably benign
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCGTCACTTAGCTCTGTGGCAAAC -3'
(R):5'- CTTGTCTCCGATCAGCATCAGAACC -3'

Sequencing Primer
(F):5'- AGCTCTGTGGCAAACCTATG -3'
(R):5'- AGAACCTAGCCCCGTTCTTG -3'
Posted On2014-05-23