Mutagenetix > Incidental Mutation

Incidental Mutation 'R1753:Adamts19'

193797

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

039785-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1753 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 59007372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 848 (I848L)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052907
AA Change: I848L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: I848L

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,973,716	F409I	probably benign	Het
Adamts5	T	C	16: 85,899,352	S306G	probably damaging	Het
Adamts8	T	G	9: 30,954,614	I486S	probably benign	Het
Adgrg5	T	C	8: 94,942,052	F499L	possibly damaging	Het
Akr1c21	T	A	13: 4,577,135	C145*	probably null	Het
Anp32b	T	G	4: 46,460,241		probably null	Het
Arhgap31	A	G	16: 38,601,612	V1364A	possibly damaging	Het
C2cd6	T	C	1: 59,094,833	R10G	possibly damaging	Het
Cacna2d1	A	G	5: 16,302,354	E367G	possibly damaging	Het
Ccdc81	C	T	7: 89,866,561	E637K	probably benign	Het
Cd2	A	T	3: 101,287,499	M91K	possibly damaging	Het
Cdc16	C	A	8: 13,764,688	Y157*	probably null	Het
Celsr3	G	T	9: 108,831,857	V1301F	probably damaging	Het
Cep164	C	T	9: 45,792,937	G961S	probably damaging	Het
Cep290	T	C	10: 100,513,981	V630A	probably benign	Het
Chd5	C	T	4: 152,378,815	S1451F	probably damaging	Het
Cldn23	A	C	8: 35,825,986	L116R	possibly damaging	Het
Cngb1	A	T	8: 95,297,773		probably benign	Het
Cpb1	G	T	3: 20,266,241	N151K	possibly damaging	Het
Cpn2	A	G	16: 30,260,100	F261S	probably damaging	Het
Crlf3	A	C	11: 80,057,872	V249G	probably damaging	Het
Csmd1	A	T	8: 16,157,120	Y1298*	probably null	Het
Cstf2t	C	A	19: 31,083,685	P207Q	possibly damaging	Het
Cym	A	C	3: 107,213,425	L288R	possibly damaging	Het
Cyp2j12	C	T	4: 96,121,432		probably null	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dnah7b	T	C	1: 46,322,335	F3465S	probably damaging	Het
Dnmt3a	A	T	12: 3,873,342	M181L	possibly damaging	Het
Duox1	T	A	2: 122,333,429	M859K	probably damaging	Het
Eif2b4	A	T	5: 31,192,940	S13T	probably benign	Het
Ercc6	T	C	14: 32,576,999	V1448A	probably benign	Het
Esp24	A	G	17: 39,040,002	E31G	possibly damaging	Het
F2rl2	T	A	13: 95,701,461	M338K	probably benign	Het
Fgfbp1	A	C	5: 43,979,923	L9R	possibly damaging	Het
Gal3st2b	A	T	1: 93,940,616	N188Y	probably damaging	Het
Gpr179	G	C	11: 97,346,578	C372W	probably damaging	Het
Grn	T	G	11: 102,433,267	C61G	probably damaging	Het
Herc1	T	G	9: 66,469,010	C3371G	probably damaging	Het
Herc1	T	C	9: 66,502,084		probably null	Het
Hmcn1	C	T	1: 150,586,468	G5153D	possibly damaging	Het
Ifi35	A	T	11: 101,456,635	R31W	probably damaging	Het
Ifit1bl1	T	A	19: 34,593,860	H399L	probably benign	Het
Irx3	G	A	8: 91,800,734	P114L	probably damaging	Het
Kat6a	T	A	8: 22,935,797	D1119E	probably benign	Het
Kmt2d	G	T	15: 98,843,482		probably benign	Het
Kng1	A	T	16: 23,079,119	H423L	possibly damaging	Het
Lrp2	T	A	2: 69,496,489	Q1746L	possibly damaging	Het
Lrrc29	A	T	8: 105,313,192	V517E	probably damaging	Het
Lrrc63	A	T	14: 75,086,344		probably null	Het
Mad2l1	T	A	6: 66,539,813	V163E	possibly damaging	Het
Map3k19	A	G	1: 127,822,680	M978T	probably benign	Het
Mon1a	A	C	9: 107,901,363	N262T	probably damaging	Het
Mpo	A	G	11: 87,795,881	N85D	probably benign	Het
Mpp4	T	C	1: 59,144,810	D244G	probably null	Het
Mstn	A	G	1: 53,066,558	Y353C	probably damaging	Het
Mx1	T	A	16: 97,454,158	N232Y	probably damaging	Het
Mycs	T	C	X: 5,468,103	R308G	probably benign	Het
Myh11	A	T	16: 14,277,870	D9E	probably benign	Het
Nfe2l3	A	T	6: 51,433,412	Q169L	probably null	Het
Nr5a1	G	T	2: 38,708,419	T122N	possibly damaging	Het
Nras	A	G	3: 103,058,979	T20A	probably damaging	Het
Obp2b	T	A	2: 25,738,640		probably null	Het
Olfr1109	T	C	2: 87,093,227	T57A	probably damaging	Het
Olfr1143	T	A	2: 87,802,762	F124L	probably benign	Het
Olfr1410	G	A	1: 92,608,400	V188M	probably benign	Het
Olfr365	A	G	2: 37,201,427	Y62C	probably damaging	Het
Olfr577	T	C	7: 102,973,056	N312S	probably benign	Het
Pcdh17	A	T	14: 84,477,654	T920S	probably benign	Het
Pcdh9	T	C	14: 93,887,225	D503G	probably benign	Het
Pcdhb12	C	T	18: 37,436,671	T290I	probably damaging	Het
Pde6b	C	A	5: 108,388,691	C84*	probably null	Het
Pex1	A	T	5: 3,630,044	N914I	probably damaging	Het
Pign	A	G	1: 105,589,317	V528A	possibly damaging	Het
Pkhd1	T	G	1: 20,533,905	D1187A	possibly damaging	Het
Ppip5k1	T	C	2: 121,342,631	K489E	probably damaging	Het
Prob1	T	C	18: 35,653,252	T650A	possibly damaging	Het
Radil	T	C	5: 142,495,336	Y572C	probably damaging	Het
Rapgef2	A	G	3: 79,088,791	I555T	possibly damaging	Het
Rgs5	G	A	1: 169,682,817		probably null	Het
Rnaset2b	G	A	17: 6,981,107		probably null	Het
S1pr1	A	G	3: 115,711,938	S336P	probably benign	Het
Slc24a5	A	G	2: 125,083,195	E252G	possibly damaging	Het
Slc34a2	A	T	5: 53,061,391	I184F	probably benign	Het
Slc35a3	A	G	3: 116,677,948	V224A	possibly damaging	Het
Slc39a9	A	G	12: 80,677,202	H211R	probably damaging	Het
Slu7	A	G	11: 43,439,268	N174S	probably benign	Het
Smarcd3	A	T	5: 24,595,822	Y131*	probably null	Het
Syne1	A	G	10: 5,367,621	M491T	probably benign	Het
Tars	G	A	15: 11,394,243	Q103*	probably null	Het
Tmem132d	C	A	5: 127,789,855	E660D	probably benign	Het
Ttn	T	C	2: 76,745,043	T16842A	probably damaging	Het
Ttn	T	A	2: 76,752,261	M22763L	probably benign	Het
Ttn	T	C	2: 76,812,972	E13201G	probably damaging	Het
Ubp1	A	T	9: 113,955,969	I117L	possibly damaging	Het
Usp24	T	A	4: 106,377,559	H954Q	probably benign	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn2r63	G	A	7: 42,928,245	Q290*	probably null	Het
Vnn3	T	C	10: 23,865,820	I341T	probably benign	Het
Wbp2nl	A	G	15: 82,305,744	T46A	probably damaging	Het
Wdr48	G	T	9: 119,924,247	E625*	probably null	Het
Wdr6	C	T	9: 108,575,164	V507I	probably damaging	Het
Zp2	A	T	7: 120,138,105	W287R	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GGCCAGTGGCTTAAGACTTGCATC -3'
(R):5'- CCGTTCCAAACAGCACAGTGTTC -3'

Sequencing Primer
(F):5'- CTTGCATCGGAGTTTGAAGACAC -3'
(R):5'- ACAGCACAGTGTTCATGGTC -3'

Posted On

2014-05-23