Incidental Mutation 'R1754:Acp4'
ID 193839
Institutional Source Beutler Lab
Gene Symbol Acp4
Ensembl Gene ENSMUSG00000012777
Gene Name acid phosphatase 4
Synonyms Acpt, EG546967
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R1754 (G1)
Quality Score 198
Status Not validated
Chromosome 7
Chromosomal Location 43901572-43906802 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43904428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 212 (I212V)
Ref Sequence ENSEMBL: ENSMUSP00000103578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012921] [ENSMUST00000055858] [ENSMUST00000071296] [ENSMUST00000084937] [ENSMUST00000107945] [ENSMUST00000107948] [ENSMUST00000107949] [ENSMUST00000107950] [ENSMUST00000118216] [ENSMUST00000146155] [ENSMUST00000137702] [ENSMUST00000188111] [ENSMUST00000145653] [ENSMUST00000186606] [ENSMUST00000191537] [ENSMUST00000185481] [ENSMUST00000187524] [ENSMUST00000188382]
AlphaFold D3YTS9
Predicted Effect probably benign
Transcript: ENSMUST00000012921
SMART Domains Protein: ENSMUSP00000012921
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055858
SMART Domains Protein: ENSMUSP00000103583
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084937
SMART Domains Protein: ENSMUSP00000095894
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107945
AA Change: I212V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103578
Gene: ENSMUSG00000012777
AA Change: I212V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 324 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107948
SMART Domains Protein: ENSMUSP00000103581
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116723
Predicted Effect probably benign
Transcript: ENSMUST00000118216
AA Change: I212V

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112922
Gene: ENSMUSG00000012777
AA Change: I212V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125318
Predicted Effect probably benign
Transcript: ENSMUST00000146155
SMART Domains Protein: ENSMUSP00000117318
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137702
SMART Domains Protein: ENSMUSP00000119445
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188111
SMART Domains Protein: ENSMUSP00000139694
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145653
Predicted Effect probably benign
Transcript: ENSMUST00000186606
SMART Domains Protein: ENSMUSP00000139441
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191537
SMART Domains Protein: ENSMUSP00000141077
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185481
SMART Domains Protein: ENSMUSP00000139913
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187524
SMART Domains Protein: ENSMUSP00000140017
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188382
SMART Domains Protein: ENSMUSP00000140200
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acid phosphatases are enzymes capable of hydrolyzing orthophosphoric acid esters in an acid medium. This gene is up-regulated by androgens and is down-regulated by estrogens in the prostate cancer cell line. This gene exhibits a lower level of expression in testicular cancer tissues than in normal tissues. The protein encoded by this gene has structural similarity to prostatic and lysosomal acid phosphatases. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Acp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Acp4 APN 7 43,902,875 (GRCm39) missense possibly damaging 0.56
IGL01067:Acp4 APN 7 43,902,876 (GRCm39) missense probably benign 0.08
IGL01739:Acp4 APN 7 43,906,210 (GRCm39) nonsense probably null
IGL02013:Acp4 APN 7 43,904,505 (GRCm39) missense probably benign 0.13
IGL02225:Acp4 APN 7 43,906,165 (GRCm39) splice site probably null
IGL02648:Acp4 APN 7 43,904,414 (GRCm39) unclassified probably benign
R0764:Acp4 UTSW 7 43,901,738 (GRCm39) unclassified probably benign
R1328:Acp4 UTSW 7 43,906,516 (GRCm39) splice site probably null
R1411:Acp4 UTSW 7 43,906,267 (GRCm39) unclassified probably benign
R2163:Acp4 UTSW 7 43,905,400 (GRCm39) missense probably damaging 1.00
R2193:Acp4 UTSW 7 43,902,993 (GRCm39) missense probably benign 0.01
R5120:Acp4 UTSW 7 43,906,395 (GRCm39) missense probably damaging 1.00
R7890:Acp4 UTSW 7 43,903,528 (GRCm39) missense probably damaging 1.00
R8557:Acp4 UTSW 7 43,905,272 (GRCm39) critical splice donor site probably null
R8915:Acp4 UTSW 7 43,903,751 (GRCm39) missense possibly damaging 0.64
R8959:Acp4 UTSW 7 43,906,399 (GRCm39) missense possibly damaging 0.95
R9685:Acp4 UTSW 7 43,906,733 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACCAGAGATGCCTTGGAATCTGAC -3'
(R):5'- TGTTACGAGAGTCCACAGAGGCAG -3'

Sequencing Primer
(F):5'- ATGCCTTGGAATCTGACATTCG -3'
(R):5'- AGCTGACTACCAGGAGGC -3'
Posted On 2014-05-23