Incidental Mutation 'R1754:Gmeb1'
ID 193823
Institutional Source Beutler Lab
Gene Symbol Gmeb1
Ensembl Gene ENSMUSG00000028901
Gene Name glucocorticoid modulatory element binding protein 1
Synonyms 1110050A04Rik
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 132221025-132261602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132232027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000131331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030733] [ENSMUST00000105964] [ENSMUST00000105965] [ENSMUST00000168553]
AlphaFold Q9JL60
Predicted Effect probably benign
Transcript: ENSMUST00000030733
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030733
Gene: ENSMUSG00000028901
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105964
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101584
Gene: ENSMUSG00000028901
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105965
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101585
Gene: ENSMUSG00000028901
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131763
Predicted Effect probably benign
Transcript: ENSMUST00000168553
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131331
Gene: ENSMUSG00000028901
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A C 1: 53,561,900 probably null Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Gmeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Gmeb1 APN 4 132227985 missense probably benign 0.00
IGL02089:Gmeb1 APN 4 132225836 missense probably damaging 1.00
R0137:Gmeb1 UTSW 4 132232108 missense probably benign 0.01
R0326:Gmeb1 UTSW 4 132242352 missense probably damaging 0.98
R0611:Gmeb1 UTSW 4 132226075 nonsense probably null
R0898:Gmeb1 UTSW 4 132234782 missense probably benign 0.01
R1317:Gmeb1 UTSW 4 132234887 nonsense probably null
R1453:Gmeb1 UTSW 4 132242448 missense possibly damaging 0.56
R1573:Gmeb1 UTSW 4 132251740 missense probably benign 0.12
R1751:Gmeb1 UTSW 4 132234887 nonsense probably null
R1761:Gmeb1 UTSW 4 132234887 nonsense probably null
R5203:Gmeb1 UTSW 4 132232009 splice site probably null
R6241:Gmeb1 UTSW 4 132242377 missense possibly damaging 0.64
R6241:Gmeb1 UTSW 4 132246013 missense probably benign 0.00
R7103:Gmeb1 UTSW 4 132234868 missense probably damaging 0.99
R7192:Gmeb1 UTSW 4 132227890 missense probably benign 0.03
R7401:Gmeb1 UTSW 4 132225774 missense probably damaging 0.97
R7528:Gmeb1 UTSW 4 132232050 missense possibly damaging 0.49
R9055:Gmeb1 UTSW 4 132237114 missense probably damaging 1.00
R9317:Gmeb1 UTSW 4 132226038 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGCGCCCATCTGTACTGTGTAACC -3'
(R):5'- TGCTGAAGTCTCAGGTCTCTGTGTC -3'

Sequencing Primer
(F):5'- GGTCTCAGGCCACCTTAAGTC -3'
(R):5'- TCTCTGAGGATGAGAGATGATAGC -3'
Posted On 2014-05-23