Incidental Mutation 'R1754:Il21'
ID 193818
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Name interleukin 21
Synonyms
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 37222759-37232636 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37225525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 114 (K114R)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
AlphaFold Q9ES17
Predicted Effect possibly damaging
Transcript: ENSMUST00000029273
AA Change: K114R

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: K114R

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161015
AA Change: K114R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: K114R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196943
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R0579:Il21 UTSW 3 37227774 missense possibly damaging 0.65
R1641:Il21 UTSW 3 37232532 missense probably benign 0.00
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4979:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R5641:Il21 UTSW 3 37227768 nonsense probably null
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
R9039:Il21 UTSW 3 37232453 missense probably benign
R9249:Il21 UTSW 3 37225528 critical splice acceptor site probably null
R9603:Il21 UTSW 3 37227800 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTCGTGAGCGTCTATAGTGTCCG -3'
(R):5'- TGCCCTGAAAGCATATCTAAAGCCC -3'

Sequencing Primer
(F):5'- CTCAGGAATCTTCGGGTCCTATG -3'
(R):5'- aggaggaggagggcgag -3'
Posted On 2014-05-23