Mutagenetix > Incidental Mutation

Incidental Mutation 'R1735:Dsel'

199605

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

039767-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.126) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 111860915 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 630 (F630Y)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000035462
AA Change: F630Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: F630Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189731

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8820:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGATTAGCCACACTGGCAAAAC -3'
(R):5'- TGCTGCTCAACATGGTGATAGGATG -3'

Sequencing Primer
(F):5'- TCCCAGGTAACTGAATCTGC -3'
(R):5'- CTTCTGCCATGAGACTGAAAAGTG -3'

Posted On

2014-05-23