Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Dsel'

650754

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111860499 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 769 (I769V)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably benign
Transcript: ENSMUST00000035462
AA Change: I769V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: I769V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Meta Mutation Damage Score

0.0574

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Adamts9	A	G	6: 92,909,687		probably null	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itch	T	C	2: 155,192,159	F417S	probably damaging	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Sphkap	A	C	1: 83,278,962	C355W	probably damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tinag	A	T	9: 76,999,849	I368K	probably benign	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Tnc	G	T	4: 64,000,724	P1154Q	possibly damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8820:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCATTTTGCACAGATGGGCTG -3'
(R):5'- TAGTTCCAGTTCTGGACTTCAG -3'

Sequencing Primer
(F):5'- GGCTGAGTGCATGTACTCCATAC -3'
(R):5'- GTCAACAGTACTGAACATAGTGTGTC -3'

Posted On

2020-09-15