Mutagenetix > Incidental Mutation

Incidental Mutation 'R8820:Dsel'

672959

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R8820 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111860264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 847 (L847P)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably benign
Transcript: ENSMUST00000035462
AA Change: L847P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: L847P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Meta Mutation Damage Score

0.0645

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,726,454	F873L	possibly damaging	Het
4930504O13Rik	T	G	11: 58,446,303	S115R	probably damaging	Het
Abca17	A	G	17: 24,328,602	L266P	probably damaging	Het
Abcb1a	A	T	5: 8,723,204	T811S	possibly damaging	Het
Als2cl	T	C	9: 110,885,787	F125L	probably benign	Het
Arhgap33	T	C	7: 30,528,740	I406V	probably benign	Het
Cdyl	T	C	13: 35,858,191	I404T	probably damaging	Het
Clasrp	C	T	7: 19,586,437	R432H	unknown	Het
Clk2	T	A	3: 89,175,423	M392K	probably damaging	Het
Cps1	T	A	1: 67,228,280	N1402K	possibly damaging	Het
Cyp2u1	T	C	3: 131,298,367	H168R	probably damaging	Het
Dapl1	T	C	2: 59,504,712	L70P	probably damaging	Het
Ddr2	T	A	1: 169,977,914	K836*	probably null	Het
Fbxw17	A	T	13: 50,433,315	K437M	possibly damaging	Het
Fktn	T	C	4: 53,735,001	V174A	possibly damaging	Het
Frem1	C	A	4: 82,903,517	S2118I	probably damaging	Het
Fzd8	G	A	18: 9,213,247	V110M	unknown	Het
Gabrb3	T	C	7: 57,792,581	S212P	probably damaging	Het
Gimap9	A	G	6: 48,677,887	D136G	probably benign	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Ift46	C	T	9: 44,790,522	T283I	probably damaging	Het
Il1f8	C	T	2: 24,159,880	Q168*	probably null	Het
Ldb2	G	A	5: 44,799,415	Q27*	probably null	Het
Lmcd1	T	A	6: 112,329,809	I314N	probably damaging	Het
Mctp2	C	A	7: 72,229,333	V259L	probably benign	Het
Midn	T	G	10: 80,154,400	S302A	probably damaging	Het
Ncor2	A	G	5: 125,029,227	V797A		Het
Npm2	A	G	14: 70,648,328	S146P	probably damaging	Het
Npr1	G	A	3: 90,464,894	R204C	probably damaging	Het
Olfr338	T	C	2: 36,376,994	S73P	probably damaging	Het
Olfr353	C	A	2: 36,890,610	M79I	probably benign	Het
Olfr49	C	T	14: 54,282,613	G94D	probably benign	Het
Olfr665	T	A	7: 104,881,655	V316D	possibly damaging	Het
Orc2	T	C	1: 58,476,480	N290D	probably benign	Het
Paip2b	A	C	6: 83,814,756	M48R	probably damaging	Het
Pcdhb15	T	A	18: 37,473,918	S68T	probably benign	Het
Pcnx	T	A	12: 81,973,248	H715Q		Het
Pcsk2	T	A	2: 143,801,070	H422Q	probably damaging	Het
Pdzph1	G	C	17: 58,880,720	Y1168*	probably null	Het
Peli2	G	A	14: 48,252,673	E201K	possibly damaging	Het
Prelp	T	C	1: 133,915,140	N89S	probably damaging	Het
Proz	T	A	8: 13,063,253	F25I	probably damaging	Het
Rapgef3	T	C	15: 97,748,657	N799S	probably benign	Het
Ryr3	G	A	2: 112,635,792	R4795W	probably damaging	Het
Ryr3	A	G	2: 112,859,724	V1180A	probably benign	Het
Scn11a	T	C	9: 119,816,520	I123V	probably benign	Het
Sema4b	G	C	7: 80,220,500	E475D	probably damaging	Het
Serinc2	C	A	4: 130,255,379	M343I	probably damaging	Het
Serinc5	G	T	13: 92,708,036	V429F	probably benign	Het
Smyd2	T	A	1: 189,899,821	K115N	probably benign	Het
Tenm3	T	G	8: 48,310,724	D765A	probably damaging	Het
Tmem2	G	A	19: 21,807,454	V434M	probably damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Ythdc2	C	T	18: 44,834,464	R176*	probably null	Het
Zfp27	T	C	7: 29,894,588	K651E	probably benign	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGAAGAAGATGAAAGTGCCC -3'
(R):5'- ACTTTTCAATGGCGGTTTTACC -3'

Sequencing Primer
(F):5'- GCCCACTGCGGATATCTGATAC -3'
(R):5'- AATGGCGGTTTTACCTTTCCTTTAG -3'

Posted On

2021-04-30