Mutagenetix > Incidental Mutation

Incidental Mutation 'R1735:Gpd2'

199611

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

MMRRC Submission

039767-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.697) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57355551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 419 (N419K)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably damaging
Transcript: ENSMUST00000028167
AA Change: N419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: N419K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112618
AA Change: N419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: N419K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

probably damaging
Transcript: ENSMUST00000169687
AA Change: N419K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: N419K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GACACGTTTCCCCATGACCTTCAG -3'
(R):5'- ATGTCCACGAACCTCGCTCTCAAG -3'

Sequencing Primer
(F):5'- AGGTCCCTTccccaccc -3'
(R):5'- TTGCCTCCTTGAAGGAACAG -3'

Posted On

2014-05-23