Mutagenetix > Incidental Mutation

Incidental Mutation 'R6137:Lamc2'

488384

Institutional Source

Beutler Lab

Gene Symbol

Lamc2

Ensembl Gene

ENSMUSG00000026479

Gene Name

laminin, gamma 2

Synonyms

nicein, 100kDa

MMRRC Submission

044284-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.469) question?

Stock #

R6137 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153122756-153186447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 153166153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 78 (R78S)

Ref Sequence

ENSEMBL: ENSMUSP00000140514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027753
AA Change: R78S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: R78S

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185356
AA Change: R78S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: R78S

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188831

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092M07Rik	A	T	19: 8,740,784	D6V	probably damaging	Het
2310057M21Rik	G	T	7: 131,357,613	H165Q	probably damaging	Het
Akap13	T	A	7: 75,677,416	F721Y	probably damaging	Het
Akap6	A	T	12: 53,140,354	D1517V	probably damaging	Het
Amigo3	T	A	9: 108,053,728	S117T	probably damaging	Het
Atf7ip2	T	A	16: 10,201,411	N34K	probably damaging	Het
Cacnb1	A	C	11: 98,005,782	V351G	probably damaging	Het
Casp9	T	A	4: 141,805,349		probably null	Het
Ccdc51	C	T	9: 109,089,415	T24I	probably benign	Het
Cdh23	T	A	10: 60,434,512	Y618F	probably damaging	Het
Chd1	T	A	17: 15,758,688	W1271R	probably damaging	Het
Dars	T	C	1: 128,368,439	T386A	probably benign	Het
Dchs1	T	A	7: 105,765,106	D834V	probably damaging	Het
Dgkd	T	A	1: 87,936,381	V933E	possibly damaging	Het
Dnah17	A	G	11: 118,025,654	F4203S	probably damaging	Het
Fancm	T	C	12: 65,130,382	L2000P	probably damaging	Het
Fbxo11	A	T	17: 88,008,669	H444Q	probably benign	Het
Fbxw14	T	A	9: 109,276,222	T292S	probably damaging	Het
Fer1l6	T	C	15: 58,559,206	S237P	probably damaging	Het
Frem3	T	C	8: 80,615,047	I1323T	probably benign	Het
Grin2a	A	G	16: 9,653,449	F652L	probably benign	Het
Grin2b	T	A	6: 135,923,458	M142L	possibly damaging	Het
Helz	A	G	11: 107,619,060	Q503R	possibly damaging	Het
Ighv5-17	A	G	12: 113,859,295	Y69H	probably benign	Het
Il17ra	A	G	6: 120,475,582	N242S	probably benign	Het
Immp1l	G	C	2: 105,964,208	G117A	probably damaging	Het
Itm2c	T	C	1: 85,894,692	V10A	probably benign	Het
Kif1b	T	C	4: 149,238,426	K679E	possibly damaging	Het
Kng1	T	C	16: 23,074,645	V256A	possibly damaging	Het
Loxl4	A	G	19: 42,598,793	F621S	probably damaging	Het
Lpl	T	A	8: 68,892,747	D134E	probably damaging	Het
Lypd3	T	C	7: 24,640,494	Y329H	probably benign	Het
Mettl13	T	C	1: 162,535,886	D225G	probably benign	Het
Myo7b	A	G	18: 31,999,974	F441L	probably damaging	Het
Nnt	T	A	13: 119,336,328	M699L	possibly damaging	Het
Nr1h3	A	T	2: 91,191,851	M144K	probably damaging	Het
Olfr1040	A	G	2: 86,145,969	V255A	probably benign	Het
Olfr1347	T	C	7: 6,488,845	T3A	probably benign	Het
Olfr325	A	T	11: 58,581,068	M75L	probably benign	Het
Pappa2	A	T	1: 158,871,543	Y667N	probably damaging	Het
Prps1l3	A	G	12: 57,238,888	I155V	probably benign	Het
Ptgs2	T	A	1: 150,100,993	N24K	probably benign	Het
Ralgds	A	T	2: 28,547,588	M514L	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Sacm1l	T	A	9: 123,569,005	V254D	probably damaging	Het
Selenot	A	T	3: 58,585,284	Q64L	probably damaging	Het
Sgsm2	G	A	11: 74,850,851	R1037W	probably damaging	Het
Slc22a12	A	G	19: 6,542,724	V10A	probably benign	Het
Spem2	G	T	11: 69,816,696	S481*	probably null	Het
Styk1	C	T	6: 131,311,016	G128D	probably damaging	Het
Tmc6	A	T	11: 117,776,328	L148Q	probably damaging	Het
Tmem138	A	C	19: 10,574,835		probably null	Het
Tnpo3	A	G	6: 29,555,268	V772A	probably benign	Het
Topaz1	T	C	9: 122,797,756	F1483S	possibly damaging	Het
Tuba4a	C	A	1: 75,216,055	C305F	probably damaging	Het
Ubap1	T	G	4: 41,379,262	F159V	possibly damaging	Het
Vmn2r9	A	G	5: 108,849,016	I129T	probably benign	Het
Wwc2	A	T	8: 47,856,263	M828K	unknown	Het
Zfp236	A	T	18: 82,671,794	S187T	possibly damaging	Het

Other mutations in Lamc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Lamc2	APN	1	153130056	missense	probably benign	0.00
IGL00907:Lamc2	APN	1	153144651	missense	probably benign	0.32
IGL02026:Lamc2	APN	1	153144736	splice site	probably benign
IGL02335:Lamc2	APN	1	153166216	missense	probably benign	0.00
IGL02568:Lamc2	APN	1	153166262	missense	possibly damaging	0.91
IGL02640:Lamc2	APN	1	153152057	missense	probably damaging	0.99
IGL02801:Lamc2	APN	1	153136783	missense	probably benign	0.10
IGL02827:Lamc2	APN	1	153139781	missense	probably damaging	1.00
IGL03240:Lamc2	APN	1	153124125	missense	probably damaging	1.00
IGL03245:Lamc2	APN	1	153133757	splice site	probably null
abasement	UTSW	1	153127025	missense	probably null	0.86
ANU74:Lamc2	UTSW	1	153131835	missense	probably benign	0.00
R0279:Lamc2	UTSW	1	153130696	missense	probably benign	0.01
R0528:Lamc2	UTSW	1	153124094	missense	probably damaging	1.00
R0597:Lamc2	UTSW	1	153133621	missense	probably benign	0.02
R0650:Lamc2	UTSW	1	153143876	missense	possibly damaging	0.88
R0826:Lamc2	UTSW	1	153152082	missense	probably damaging	1.00
R1015:Lamc2	UTSW	1	153166199	missense	possibly damaging	0.53
R1172:Lamc2	UTSW	1	153166287	missense	probably damaging	1.00
R1308:Lamc2	UTSW	1	153150818	missense	probably damaging	1.00
R1521:Lamc2	UTSW	1	153166263	missense	probably benign	0.11
R1525:Lamc2	UTSW	1	153130756	missense	probably benign	0.00
R1602:Lamc2	UTSW	1	153127028	missense	probably benign	0.00
R1631:Lamc2	UTSW	1	153158934	missense	possibly damaging	0.95
R1633:Lamc2	UTSW	1	153141698	nonsense	probably null
R1832:Lamc2	UTSW	1	153166187	missense	possibly damaging	0.72
R1978:Lamc2	UTSW	1	153133597	critical splice donor site	probably null
R1996:Lamc2	UTSW	1	153154470	missense	possibly damaging	0.84
R2046:Lamc2	UTSW	1	153141765	missense	probably benign	0.01
R2107:Lamc2	UTSW	1	153154386	splice site	probably benign
R2130:Lamc2	UTSW	1	153127124	missense	probably damaging	1.00
R2182:Lamc2	UTSW	1	153126866	missense	possibly damaging	0.46
R2207:Lamc2	UTSW	1	153133706	missense	possibly damaging	0.68
R2218:Lamc2	UTSW	1	153130779	missense	probably benign	0.21
R3772:Lamc2	UTSW	1	153124251	missense	probably benign
R4616:Lamc2	UTSW	1	153166169	missense	probably damaging	1.00
R4874:Lamc2	UTSW	1	153154395	missense	probably null	1.00
R4939:Lamc2	UTSW	1	153126836	missense	probably damaging	1.00
R4985:Lamc2	UTSW	1	153136805	missense	probably benign
R5544:Lamc2	UTSW	1	153124053	missense	possibly damaging	0.93
R5632:Lamc2	UTSW	1	153131890	missense	probably damaging	1.00
R5771:Lamc2	UTSW	1	153141594	missense	probably benign	0.04
R5811:Lamc2	UTSW	1	153166253	missense	possibly damaging	0.53
R6058:Lamc2	UTSW	1	153136829	missense	probably benign	0.01
R6130:Lamc2	UTSW	1	153136777	missense	probably benign	0.01
R6994:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6995:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6997:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R7000:Lamc2	UTSW	1	153166127	missense	possibly damaging	0.72
R7018:Lamc2	UTSW	1	153136742	missense	probably benign	0.00
R7145:Lamc2	UTSW	1	153130772	missense	possibly damaging	0.95
R7148:Lamc2	UTSW	1	153185984	missense	probably benign	0.01
R7171:Lamc2	UTSW	1	153139749	missense	probably damaging	1.00
R7640:Lamc2	UTSW	1	153136804	missense	possibly damaging	0.79
R7673:Lamc2	UTSW	1	153124036	missense	probably damaging	1.00
R7684:Lamc2	UTSW	1	153127025	missense	probably null	0.86
R7712:Lamc2	UTSW	1	153133611	missense	possibly damaging	0.81
R7940:Lamc2	UTSW	1	153130775	nonsense	probably null
R8153:Lamc2	UTSW	1	153124104	frame shift	probably null
R8211:Lamc2	UTSW	1	153166278	missense	probably damaging	1.00
R8486:Lamc2	UTSW	1	153158891	missense	probably benign
R8739:Lamc2	UTSW	1	153144653	nonsense	probably null
R8744:Lamc2	UTSW	1	153143738	missense	probably benign	0.19
R8911:Lamc2	UTSW	1	153152127	missense	probably damaging	1.00
R9435:Lamc2	UTSW	1	153137326	missense	probably benign	0.00
R9457:Lamc2	UTSW	1	153139854	missense	probably benign
RF024:Lamc2	UTSW	1	153152055	missense	possibly damaging	0.70
Z1176:Lamc2	UTSW	1	153133621	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACTCTGATGAACCTGGCTCC -3'
(R):5'- TGTTAGCCCATGCATAACAGATG -3'

Sequencing Primer
(F):5'- CCCAGGGGGCGTTGTTAAAAC -3'
(R):5'- GATCTTTGTTTCTGACAATGTCTCTG -3'

Posted On

2017-10-10