Incidental Mutation 'R1883:Prex1'
ID209223
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R1883 (G1)
Quality Score147
Status Not validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166583272 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 938 (D938G)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
Predicted Effect probably benign
Transcript: ENSMUST00000036719
AA Change: D1108G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: D1108G

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
AA Change: D938G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: D938G

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109246
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nipbl A C 15: 8,327,132 F1590C probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pde10a A T 17: 8,978,944 T671S possibly damaging Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Ptch1 G A 13: 63,512,027 Q1134* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V137A probably benign Het
Rps6ka1 A C 4: 133,864,043 I299S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K8* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tlr7 C T X: 167,306,472 G673S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps54 A T 11: 21,312,967 T685S possibly damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCAGAAGCCTCAGTTGTC -3'
(R):5'- CTTCCAAGGGGCAAAGACTG -3'

Sequencing Primer
(F):5'- AGAAGCCTCAGTTGTCCGGTG -3'
(R):5'- GCTGGGTAGCTTCCCCCTC -3'
Posted On2014-06-30