Incidental Mutation 'R1893:Sptan1'
ID211673
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Namespectrin alpha, non-erythrocytic 1
Synonymsalpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 039913-MU
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1893 (G1)
Quality Score180
Status Validated
Chromosome2
Chromosomal Location29965560-30031451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30020460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1812 (D1812E)
Ref Sequence ENSEMBL: ENSMUSP00000047792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably damaging
Transcript: ENSMUST00000046257
AA Change: D1812E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: D1812E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: D1832E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: D1832E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
AA Change: D1837E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: D1837E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
AA Change: D1817E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: D1817E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
AA Change: D1817E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: D1817E

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: D1837E
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: D1837E

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Meta Mutation Damage Score 0.2287 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0396:Sptan1 UTSW 2 29991033 missense probably damaging 1.00
R0423:Sptan1 UTSW 2 30028672 missense probably null
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1537:Sptan1 UTSW 2 30026022 missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 30027127 missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29983209 missense probably benign 0.02
R7248:Sptan1 UTSW 2 30002299 missense probably benign 0.10
R7282:Sptan1 UTSW 2 29986929 missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29980197 missense probably damaging 1.00
R7585:Sptan1 UTSW 2 30000056 missense probably benign 0.06
R7779:Sptan1 UTSW 2 30021307 missense probably damaging 1.00
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCATGAAGAAGCAATTGTG -3'
(R):5'- AGGCTAATACCTGACAGCCC -3'

Sequencing Primer
(F):5'- GCCTCCTAAGTGCTGGCATTAAAG -3'
(R):5'- CAGGAGGGGCCAGGCTTTC -3'
Posted On2014-06-30