Mutagenetix > Incidental Mutations

Incidental Mutation 'R1893:Sptan1'

211673

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

039913-MU

Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1893 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

29965560-30031451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30020460 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1812 (D1812E)

Ref Sequence

ENSEMBL: ENSMUSP00000047792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046257
AA Change: D1812E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: D1812E

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095083
AA Change: D1832E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: D1832E

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100225
AA Change: D1837E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: D1837E

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113717
AA Change: D1817E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: D1817E

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113719
AA Change: D1817E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: D1817E

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000129241
AA Change: D1837E

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: D1837E

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149846

Meta Mutation Damage Score

0.2287

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

99% (99/100)

MGI Phenotype

Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,267,809	Y674H	possibly damaging	Het
Aars2	G	A	17: 45,514,799	R347Q	probably benign	Het
Abca15	A	T	7: 120,340,553	M293L	possibly damaging	Het
Abcb7	A	T	X: 104,342,536	H97Q	probably damaging	Het
Aldh1l2	G	T	10: 83,492,536	N772K	probably damaging	Het
Ascc2	T	A	11: 4,672,305	L457Q	probably benign	Het
Aspm	T	A	1: 139,479,867	I2164N	probably damaging	Het
Cabs1	A	G	5: 87,980,035	T182A	probably benign	Het
Carmil1	T	C	13: 24,024,463	E833G	possibly damaging	Het
Ccdc102a	G	A	8: 94,913,543	T41M	probably damaging	Het
Clec2h	T	C	6: 128,670,832	V48A	probably benign	Het
Cpb2	G	A	14: 75,255,963	V27I	probably benign	Het
Cr2	T	C	1: 195,155,187	H1201R	probably benign	Het
Cyp2d9	T	C	15: 82,452,606	V52A	probably damaging	Het
Cyp4a12a	C	A	4: 115,326,667	N223K	probably benign	Het
Cyp7b1	G	A	3: 18,096,567	S336L	possibly damaging	Het
D230025D16Rik	G	T	8: 105,246,501	V248F	probably damaging	Het
Dnah10	T	C	5: 124,754,317	V803A	probably benign	Het
Dnah17	T	A	11: 118,066,968	T2745S	probably benign	Het
E330021D16Rik	A	G	6: 136,401,827	S2P	possibly damaging	Het
Ep300	T	A	15: 81,631,646		probably benign	Het
Epha3	A	G	16: 63,568,399	S829P	probably damaging	Het
Fads3	C	A	19: 10,056,504	H418N	probably benign	Het
Fat1	T	C	8: 45,023,856	S1980P	probably damaging	Het
Fgf20	T	C	8: 40,279,803	E198G	possibly damaging	Het
Fgl2	G	A	5: 21,375,671	R337H	probably benign	Het
Gbp2	G	T	3: 142,630,172		probably benign	Het
Gja10	G	A	4: 32,601,541	S281L	probably benign	Het
Gm5422	G	A	10: 31,249,613		noncoding transcript	Het
Gmpr	T	A	13: 45,520,947	D129E	possibly damaging	Het
Gtf3c4	C	T	2: 28,834,362	V453I	possibly damaging	Het
Heatr6	T	C	11: 83,757,314	V111A	probably benign	Het
Hipk3	G	A	2: 104,433,256	R905W	probably damaging	Het
Hpn	T	A	7: 31,099,348	D103V	probably damaging	Het
Ipcef1	G	A	10: 6,900,680	R304W	probably damaging	Het
Iqcb1	A	G	16: 36,831,883	D52G	probably damaging	Het
Klhdc7b	C	T	15: 89,387,695		probably null	Het
Klhl1	A	T	14: 96,240,206		probably null	Het
Lrrn1	A	T	6: 107,568,122	I294F	possibly damaging	Het
Map3k1	A	T	13: 111,768,033	F406I	possibly damaging	Het
Map4k4	T	A	1: 40,001,557	V579E	probably benign	Het
Mapre2	A	G	18: 23,853,717	K62R	probably damaging	Het
Mdga1	A	T	17: 29,849,226	Y305N	probably damaging	Het
Mgl2	T	A	11: 70,134,167		probably null	Het
Mnx1	C	T	5: 29,477,830	G149D	unknown	Het
Mtbp	T	A	15: 55,557,668	S17T	probably benign	Het
Neu3	T	C	7: 99,823,420	T37A	possibly damaging	Het
Nr1i3	T	C	1: 171,217,223		probably null	Het
Odf3l1	A	G	9: 56,849,214	Y173H	probably benign	Het
Olfr118	A	T	17: 37,672,856	K278*	probably null	Het
Olfr466	T	A	13: 65,152,992	M256K	possibly damaging	Het
Olfr522	T	C	7: 140,162,821	N43S	probably damaging	Het
Olfr981	A	T	9: 40,022,974	I194F	possibly damaging	Het
Osr2	A	G	15: 35,300,462	T55A	possibly damaging	Het
Palld	A	G	8: 61,516,621	V981A	probably damaging	Het
Pbx1	A	T	1: 168,203,410	M213K	possibly damaging	Het
Pcdhb12	C	A	18: 37,437,083	H427Q	probably benign	Het
Perm1	C	T	4: 156,217,883	R295C	probably benign	Het
Polm	T	C	11: 5,835,574	T162A	possibly damaging	Het
Prox1	A	G	1: 190,160,518		probably benign	Het
Ptpn7	A	T	1: 135,134,903	T127S	probably benign	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Rab21	T	C	10: 115,290,900	T181A	probably benign	Het
Rab38	A	T	7: 88,490,716	T198S	probably benign	Het
Rnase4	C	G	14: 51,104,938	Q40E	possibly damaging	Het
Rnf213	T	A	11: 119,416,448	W645R	probably damaging	Het
Rnf8	A	G	17: 29,621,550	I51M	probably damaging	Het
Sbpl	T	A	17: 23,953,267	D226V	unknown	Het
Sdf4	T	G	4: 156,000,748	I180S	probably benign	Het
Simc1	A	G	13: 54,539,715	K99R	probably damaging	Het
Slc2a4	T	C	11: 69,946,572	Q49R	probably damaging	Het
Slco1a4	T	C	6: 141,834,616		probably null	Het
Slco5a1	C	A	1: 12,894,472	C527F	probably damaging	Het
Sox6	T	A	7: 115,544,568	N405I	probably benign	Het
Sphkap	G	A	1: 83,278,966	P354L	probably benign	Het
Spi1	A	G	2: 91,114,357	D149G	probably benign	Het
Sub1	A	T	15: 11,991,044	V37E	possibly damaging	Het
Sult2a6	T	C	7: 14,225,889	T240A	probably benign	Het
Tacc2	A	G	7: 130,625,325	S1247G	probably benign	Het
Taf4	T	C	2: 179,933,030	D594G	probably damaging	Het
Tap1	T	G	17: 34,194,941	D643E	probably damaging	Het
Ticam1	T	C	17: 56,271,894	N67S	probably benign	Het
Tlr6	A	G	5: 64,953,213	F784L	probably damaging	Het
Tmprss15	A	G	16: 79,071,418	V202A	probably benign	Het
Trp53bp2	T	C	1: 182,431,628	V82A	probably benign	Het
Ube2o	C	T	11: 116,548,835	V170I	possibly damaging	Het
Vmn1r177	G	A	7: 23,866,148	T101I	probably benign	Het
Vmn2r68	A	T	7: 85,234,659	Y79*	probably null	Het
Wdr35	A	C	12: 8,985,994	Y255S	probably benign	Het
Zfp507	A	T	7: 35,802,627		probably benign	Het
Zfp688	G	A	7: 127,419,237	R239C	probably damaging	Het
Zfp74	T	A	7: 29,936,045		probably null	Het
Zfp932	A	G	5: 110,009,203	N223D	possibly damaging	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29993956	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	30015610	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	30000071	splice site	probably benign
IGL01070:Sptan1	APN	2	30014173	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	30026114	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	30018479	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	30018489	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	30019968	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	30013713	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	30030324	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	30030740	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	30016055	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	30018474	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29998183	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29978576	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29996043	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29991033	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29986493	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	30025581	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0094:Sptan1	UTSW	2	30006623	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	30010692	splice site	probably benign
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29992752	splice site	probably null
R0368:Sptan1	UTSW	2	29993915	missense	probably benign	0.29
R0396:Sptan1	UTSW	2	29991033	missense	probably damaging	1.00
R0423:Sptan1	UTSW	2	30028672	missense	probably null
R0448:Sptan1	UTSW	2	30026810	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	30013848	splice site	probably benign
R0580:Sptan1	UTSW	2	30007575	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	30013518	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29980063	splice site	probably null
R1352:Sptan1	UTSW	2	30021187	splice site	probably benign
R1456:Sptan1	UTSW	2	29980203	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	30026022	missense	possibly damaging	0.95
R1542:Sptan1	UTSW	2	30027127	missense	probably damaging	1.00
R1612:Sptan1	UTSW	2	30003336	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29986420	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29992001	splice site	probably benign
R1879:Sptan1	UTSW	2	29995528	missense	probably damaging	1.00
R1914:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	30007561	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	30002238	missense	probably benign
R2103:Sptan1	UTSW	2	30030471	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	30018576	splice site	probably benign
R2931:Sptan1	UTSW	2	30018488	missense	probably benign
R3726:Sptan1	UTSW	2	30018419	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	30030025	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	30026588	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	30025569	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	30029709	intron	probably benign
R4718:Sptan1	UTSW	2	30031062	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29996435	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	30011042	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29978443	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29993724	intron	probably benign
R5181:Sptan1	UTSW	2	29993724	intron	probably benign
R5383:Sptan1	UTSW	2	30011328	missense	probably damaging	1.00
R5573:Sptan1	UTSW	2	29986492	nonsense	probably null
R5592:Sptan1	UTSW	2	29986719	intron	probably benign
R5639:Sptan1	UTSW	2	29990993	nonsense	probably null
R5801:Sptan1	UTSW	2	30030601	splice site	probably null
R5947:Sptan1	UTSW	2	29994367	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29996782	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29993887	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	30004523	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	30007549	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	30018515	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	30030973	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29983209	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	30002299	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29986929	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29980197	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	30000056	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	30021307	missense	probably damaging	1.00
X0028:Sptan1	UTSW	2	30020030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCATGAAGAAGCAATTGTG -3'
(R):5'- AGGCTAATACCTGACAGCCC -3'

Sequencing Primer
(F):5'- GCCTCCTAAGTGCTGGCATTAAAG -3'
(R):5'- CAGGAGGGGCCAGGCTTTC -3'

Posted On

2014-06-30