Incidental Mutation 'R1939:Nudt6'
ID213791
Institutional Source Beutler Lab
Gene Symbol Nudt6
Ensembl Gene ENSMUSG00000050174
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 6
Synonyms
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37404910-37420211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37405230 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000142588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038885] [ENSMUST00000052645] [ENSMUST00000091203] [ENSMUST00000099130] [ENSMUST00000108117] [ENSMUST00000108118] [ENSMUST00000108120] [ENSMUST00000138563] [ENSMUST00000141438] [ENSMUST00000146324] [ENSMUST00000149449] [ENSMUST00000200585]
Predicted Effect probably benign
Transcript: ENSMUST00000038885
SMART Domains Protein: ENSMUSP00000037694
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052645
AA Change: Y270C

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056219
Gene: ENSMUSG00000050174
AA Change: Y270C

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 270 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091203
SMART Domains Protein: ENSMUSP00000088742
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 109 3.67e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099130
AA Change: Y269C

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096733
Gene: ENSMUSG00000050174
AA Change: Y269C

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 269 7.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108117
SMART Domains Protein: ENSMUSP00000103752
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 76 3e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000108118
AA Change: Y202C

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103753
Gene: ENSMUSG00000050174
AA Change: Y202C

DomainStartEndE-ValueType
Pfam:NUDIX 73 202 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108120
SMART Domains Protein: ENSMUSP00000103755
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 106 3.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133894
Predicted Effect probably benign
Transcript: ENSMUST00000138563
SMART Domains Protein: ENSMUSP00000122227
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138710
Predicted Effect probably damaging
Transcript: ENSMUST00000141438
AA Change: Y54C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142588
Gene: ENSMUSG00000050174
AA Change: Y54C

DomainStartEndE-ValueType
PDB:3H95|A 2 97 5e-55 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145228
Predicted Effect probably benign
Transcript: ENSMUST00000146324
AA Change: Y104C

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142653
Gene: ENSMUSG00000050174
AA Change: Y104C

DomainStartEndE-ValueType
Pfam:NUDIX 1 104 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149449
SMART Domains Protein: ENSMUSP00000116572
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 3e-44 PDB
PDB:3H95|A 132 191 6e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150021
Predicted Effect probably benign
Transcript: ENSMUST00000198158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199938
Predicted Effect probably benign
Transcript: ENSMUST00000200585
SMART Domains Protein: ENSMUSP00000143094
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Nudt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Nudt6 APN 3 37405171 missense probably benign 0.03
IGL02965:Nudt6 APN 3 37419506 missense probably damaging 0.99
IGL02975:Nudt6 APN 3 37419518 missense probably damaging 1.00
R0927:Nudt6 UTSW 3 37405353 missense probably benign 0.01
R1884:Nudt6 UTSW 3 37412400 missense probably benign 0.02
R2122:Nudt6 UTSW 3 37412405 missense probably benign 0.01
R4416:Nudt6 UTSW 3 37405229 unclassified probably null
R4801:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R4802:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R5826:Nudt6 UTSW 3 37419468 missense probably benign 0.05
R6362:Nudt6 UTSW 3 37419489 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TATGTGAGAAAACTGGCGTCAG -3'
(R):5'- GGTGTCAAGTCAGAATTCAGGTC -3'

Sequencing Primer
(F):5'- ACTGGCGTCAGGTTGAAATC -3'
(R):5'- CAAGTCAGAATTCAGGTCCCTGTTG -3'
Posted On2014-07-14