Incidental Mutation 'R1899:Tbc1d17'
ID 214088
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene Name TBC1 domain family, member 17
Synonyms
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R1899 (G1)
Quality Score 194
Status Validated
Chromosome 7
Chromosomal Location 44490200-44498503 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 44491057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959] [ENSMUST00000207293]
AlphaFold Q8BYH7
Predicted Effect probably benign
Transcript: ENSMUST00000033015
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44,492,509 (GRCm39) missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44,494,737 (GRCm39) missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44,492,113 (GRCm39) missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44,497,753 (GRCm39) missense probably benign
IGL02829:Tbc1d17 APN 7 44,498,296 (GRCm39) unclassified probably benign
PIT4431001:Tbc1d17 UTSW 7 44,494,498 (GRCm39) missense probably benign
R0035:Tbc1d17 UTSW 7 44,490,832 (GRCm39) missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44,490,832 (GRCm39) missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44,493,495 (GRCm39) unclassified probably benign
R0066:Tbc1d17 UTSW 7 44,493,495 (GRCm39) unclassified probably benign
R0414:Tbc1d17 UTSW 7 44,495,483 (GRCm39) missense probably benign 0.00
R0574:Tbc1d17 UTSW 7 44,492,547 (GRCm39) unclassified probably benign
R0626:Tbc1d17 UTSW 7 44,492,509 (GRCm39) missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44,497,852 (GRCm39) splice site probably benign
R1203:Tbc1d17 UTSW 7 44,492,895 (GRCm39) missense probably damaging 1.00
R1244:Tbc1d17 UTSW 7 44,493,822 (GRCm39) missense probably damaging 0.99
R1730:Tbc1d17 UTSW 7 44,494,555 (GRCm39) missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44,494,555 (GRCm39) missense probably damaging 0.99
R1953:Tbc1d17 UTSW 7 44,490,822 (GRCm39) splice site probably null
R2106:Tbc1d17 UTSW 7 44,497,692 (GRCm39) critical splice donor site probably null
R3889:Tbc1d17 UTSW 7 44,495,362 (GRCm39) missense probably damaging 1.00
R4240:Tbc1d17 UTSW 7 44,496,250 (GRCm39) missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44,490,771 (GRCm39) missense probably benign
R4787:Tbc1d17 UTSW 7 44,492,488 (GRCm39) missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44,498,292 (GRCm39) start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44,497,755 (GRCm39) missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44,494,761 (GRCm39) missense probably damaging 0.96
R6502:Tbc1d17 UTSW 7 44,491,049 (GRCm39) missense probably benign 0.30
R6838:Tbc1d17 UTSW 7 44,493,738 (GRCm39) missense probably damaging 0.97
R7543:Tbc1d17 UTSW 7 44,495,503 (GRCm39) missense probably benign 0.00
R8118:Tbc1d17 UTSW 7 44,492,426 (GRCm39) missense probably benign 0.10
R8899:Tbc1d17 UTSW 7 44,492,328 (GRCm39) missense probably damaging 1.00
R9391:Tbc1d17 UTSW 7 44,494,683 (GRCm39) missense probably damaging 1.00
R9776:Tbc1d17 UTSW 7 44,490,696 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d17 UTSW 7 44,492,095 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGAGGCTAGTTGATGGG -3'
(R):5'- CCCACTTACCAGGTTACTAGGC -3'

Sequencing Primer
(F):5'- CAAGAGGCTAGTTGATGGGTGAGG -3'
(R):5'- ACTTACCAGGTTACTAGGCTGTAC -3'
Posted On 2014-07-14