Incidental Mutation 'R1899:Srebf1'
ID214117
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Namesterol regulatory element binding transcription factor 1
SynonymsSREBP-1a, SREBP-1c, ADD-1, SREBP1c, SREBP-1, bHLHd1, SREBP1
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1899 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location60199089-60222581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60203486 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 601 (L601P)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000064190] [ENSMUST00000102688] [ENSMUST00000144942] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000020846
AA Change: L625P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: L625P

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064190
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102688
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129869
Predicted Effect probably damaging
Transcript: ENSMUST00000134660
AA Change: L566P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: L566P

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141161
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: L601P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: L601P

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156304
Predicted Effect probably benign
Transcript: ENSMUST00000171108
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Meta Mutation Damage Score 0.9630 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60204131 missense probably benign 0.01
IGL02097:Srebf1 APN 11 60202824 missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60201713 critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60220458 missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60207076 synonymous silent
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0550:Srebf1 UTSW 11 60201676 missense probably benign 0.00
R0654:Srebf1 UTSW 11 60204116 missense probably benign
R0707:Srebf1 UTSW 11 60204116 missense probably benign
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1584:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1900:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1905:Srebf1 UTSW 11 60204493 missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60206502 missense probably benign
R2191:Srebf1 UTSW 11 60220539 missense probably damaging 1.00
R2267:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R2268:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60210358 utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60207104 missense possibly damaging 0.82
R6371:Srebf1 UTSW 11 60203515 missense probably damaging 1.00
R6376:Srebf1 UTSW 11 60203535 missense probably null 0.19
R7009:Srebf1 UTSW 11 60200526 missense probably damaging 1.00
R7029:Srebf1 UTSW 11 60206984 missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60205867 missense probably benign 0.03
R7569:Srebf1 UTSW 11 60200121 missense possibly damaging 0.69
R8317:Srebf1 UTSW 11 60200657 missense possibly damaging 0.62
R8370:Srebf1 UTSW 11 60202196 missense probably benign
RF009:Srebf1 UTSW 11 60204116 missense probably benign
X0017:Srebf1 UTSW 11 60202881 missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60203427 missense probably benign 0.00
Z1176:Srebf1 UTSW 11 60207156 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACTTGCCTGCAAAGTGGG -3'
(R):5'- TCAGAGCTCCTGACTCTAGG -3'

Sequencing Primer
(F):5'- CCTGCAAAGTGGGTGAGGC -3'
(R):5'- ACTCTAGGGGCCCAGACAAG -3'
Posted On2014-07-14