Incidental Mutation 'R1899:Srebf1'
ID 214117
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Name sterol regulatory element binding transcription factor 1
Synonyms SREBP1c, bHLHd1, SREBP1, ADD-1, SREBP-1c, SREBP-1, SREBP-1a
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1899 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 60089915-60113407 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60094312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 601 (L601P)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000064190] [ENSMUST00000102688] [ENSMUST00000144942] [ENSMUST00000171108]
AlphaFold Q9WTN3
Predicted Effect probably damaging
Transcript: ENSMUST00000020846
AA Change: L625P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: L625P

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064190
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102688
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129869
Predicted Effect probably damaging
Transcript: ENSMUST00000134660
AA Change: L566P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: L566P

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149238
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: L601P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: L601P

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156304
Predicted Effect probably benign
Transcript: ENSMUST00000171108
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Meta Mutation Damage Score 0.9630 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60,095,965 (GRCm39) missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60,095,965 (GRCm39) missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60,094,957 (GRCm39) missense probably benign 0.01
IGL02097:Srebf1 APN 11 60,093,650 (GRCm39) missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60,092,539 (GRCm39) critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60,111,284 (GRCm39) missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60,097,902 (GRCm39) synonymous silent
R0109:Srebf1 UTSW 11 60,092,630 (GRCm39) missense probably benign 0.21
R0109:Srebf1 UTSW 11 60,092,630 (GRCm39) missense probably benign 0.21
R0550:Srebf1 UTSW 11 60,092,502 (GRCm39) missense probably benign 0.00
R0654:Srebf1 UTSW 11 60,094,942 (GRCm39) missense probably benign
R0707:Srebf1 UTSW 11 60,094,942 (GRCm39) missense probably benign
R1466:Srebf1 UTSW 11 60,091,528 (GRCm39) missense probably benign 0.01
R1466:Srebf1 UTSW 11 60,091,528 (GRCm39) missense probably benign 0.01
R1584:Srebf1 UTSW 11 60,091,528 (GRCm39) missense probably benign 0.01
R1900:Srebf1 UTSW 11 60,094,312 (GRCm39) missense probably damaging 1.00
R1905:Srebf1 UTSW 11 60,095,319 (GRCm39) missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60,097,328 (GRCm39) missense probably benign
R2191:Srebf1 UTSW 11 60,111,365 (GRCm39) missense probably damaging 1.00
R2267:Srebf1 UTSW 11 60,097,973 (GRCm39) missense probably damaging 0.99
R2268:Srebf1 UTSW 11 60,097,973 (GRCm39) missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60,101,184 (GRCm39) utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60,094,410 (GRCm39) missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60,094,410 (GRCm39) missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60,097,930 (GRCm39) missense possibly damaging 0.82
R6371:Srebf1 UTSW 11 60,094,341 (GRCm39) missense probably damaging 1.00
R6376:Srebf1 UTSW 11 60,094,361 (GRCm39) missense probably null 0.19
R7009:Srebf1 UTSW 11 60,091,352 (GRCm39) missense probably damaging 1.00
R7029:Srebf1 UTSW 11 60,097,810 (GRCm39) missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60,096,693 (GRCm39) missense probably benign 0.03
R7569:Srebf1 UTSW 11 60,090,947 (GRCm39) missense possibly damaging 0.69
R8317:Srebf1 UTSW 11 60,091,483 (GRCm39) missense possibly damaging 0.62
R8370:Srebf1 UTSW 11 60,093,022 (GRCm39) missense probably benign
R8871:Srebf1 UTSW 11 60,091,595 (GRCm39) missense probably benign
R9433:Srebf1 UTSW 11 60,095,015 (GRCm39) missense possibly damaging 0.63
R9582:Srebf1 UTSW 11 60,097,868 (GRCm39) missense probably benign 0.00
RF009:Srebf1 UTSW 11 60,094,942 (GRCm39) missense probably benign
X0017:Srebf1 UTSW 11 60,093,707 (GRCm39) missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60,094,253 (GRCm39) missense probably benign 0.00
Z1176:Srebf1 UTSW 11 60,097,982 (GRCm39) missense possibly damaging 0.95
Z1186:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1187:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1188:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1189:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1190:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1191:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Z1192:Srebf1 UTSW 11 60,097,061 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACTTGCCTGCAAAGTGGG -3'
(R):5'- TCAGAGCTCCTGACTCTAGG -3'

Sequencing Primer
(F):5'- CCTGCAAAGTGGGTGAGGC -3'
(R):5'- ACTCTAGGGGCCCAGACAAG -3'
Posted On 2014-07-14