Incidental Mutation 'R1899:Srsf11'
ID 214061
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Name serine and arginine-rich splicing factor 11
Synonyms Sfrs11, 2610019N13Rik, 0610009J05Rik
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1899 (G1)
Quality Score 135
Status Validated
Chromosome 3
Chromosomal Location 157716552-157742311 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 157737217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444]
AlphaFold E9Q6E5
Predicted Effect unknown
Transcript: ENSMUST00000069025
AA Change: S35R
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: S35R

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000072875
AA Change: S18R
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: S18R

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect unknown
Transcript: ENSMUST00000121326
AA Change: S53R
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: S53R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126716
AA Change: S18R
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436
AA Change: S18R

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133090
Predicted Effect unknown
Transcript: ENSMUST00000137444
AA Change: S18R
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436
AA Change: S18R

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140491
SMART Domains Protein: ENSMUSP00000118767
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
Blast:RRM 2 42 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147304
SMART Domains Protein: ENSMUSP00000115487
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
RRM 7 81 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198192
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 157,717,672 (GRCm39) unclassified probably benign
IGL01600:Srsf11 APN 3 157,725,079 (GRCm39) splice site probably benign
IGL02724:Srsf11 APN 3 157,722,068 (GRCm39) unclassified probably benign
IGL03147:Srsf11 UTSW 3 157,732,377 (GRCm39) missense probably damaging 1.00
R0195:Srsf11 UTSW 3 157,742,172 (GRCm39) unclassified probably benign
R0578:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R0580:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R1075:Srsf11 UTSW 3 157,718,427 (GRCm39) intron probably benign
R1604:Srsf11 UTSW 3 157,724,948 (GRCm39) critical splice donor site probably null
R1797:Srsf11 UTSW 3 157,725,065 (GRCm39) missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 157,722,064 (GRCm39) unclassified probably benign
R2105:Srsf11 UTSW 3 157,724,982 (GRCm39) missense probably damaging 0.99
R4605:Srsf11 UTSW 3 157,728,560 (GRCm39) nonsense probably null
R4655:Srsf11 UTSW 3 157,728,972 (GRCm39) missense probably benign 0.15
R4737:Srsf11 UTSW 3 157,732,369 (GRCm39) nonsense probably null
R5244:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5245:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5379:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5401:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5625:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5763:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5814:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5938:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5944:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5945:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6126:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6175:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6427:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6435:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6436:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6614:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6616:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R7615:Srsf11 UTSW 3 157,722,062 (GRCm39) missense unknown
R8787:Srsf11 UTSW 3 157,718,037 (GRCm39) missense unknown
R9352:Srsf11 UTSW 3 157,717,836 (GRCm39) missense unknown
R9547:Srsf11 UTSW 3 157,717,735 (GRCm39) missense unknown
X0017:Srsf11 UTSW 3 157,721,986 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTAAACTCCAATCGGGCGC -3'
(R):5'- ACGCGTACTTCCGGGATATG -3'

Sequencing Primer
(F):5'- TAAACTCCAATCGGGCGCTTATC -3'
(R):5'- TACTTCCGGGATATGGGCGC -3'
Posted On 2014-07-14