Incidental Mutation 'R1913:Mep1b'
ID214635
Institutional Source Beutler Lab
Gene Symbol Mep1b
Ensembl Gene ENSMUSG00000024313
Gene Namemeprin 1 beta
SynonymsMep-1b, meprin beta
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location21072344-21100199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21093229 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 383 (I383F)
Ref Sequence ENSEMBL: ENSMUSP00000080866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082235]
Predicted Effect probably benign
Transcript: ENSMUST00000082235
AA Change: I383F

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080866
Gene: ENSMUSG00000024313
AA Change: I383F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 42 N/A INTRINSIC
ZnMc 68 208 1.23e-54 SMART
MAM 261 430 1.91e-52 SMART
MATH 433 569 4.88e-8 SMART
EGF 610 647 2.35e-2 SMART
transmembrane domain 658 680 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit 50% prenatal lethality; survivors have reduced birth weight and show altered renal gene expression, but otherwise are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Mep1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Mep1b APN 18 21084186 nonsense probably null
IGL01470:Mep1b APN 18 21097467 missense probably benign 0.26
IGL01866:Mep1b APN 18 21094993 missense probably benign 0.34
IGL02865:Mep1b APN 18 21093384 missense probably benign 0.02
IGL03093:Mep1b APN 18 21093653 missense probably benign 0.01
IGL03126:Mep1b APN 18 21088560 missense probably damaging 1.00
IGL03196:Mep1b APN 18 21095064 missense probably benign 0.01
P0022:Mep1b UTSW 18 21088541 splice site probably benign
R0143:Mep1b UTSW 18 21095107 splice site probably benign
R0743:Mep1b UTSW 18 21080458 missense possibly damaging 0.81
R0961:Mep1b UTSW 18 21088729 nonsense probably null
R2162:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R2307:Mep1b UTSW 18 21088575 missense probably damaging 1.00
R3000:Mep1b UTSW 18 21093304 missense probably damaging 0.96
R3833:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3862:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3863:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3864:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R4171:Mep1b UTSW 18 21095106 splice site probably null
R4774:Mep1b UTSW 18 21086184 missense probably benign 0.24
R4798:Mep1b UTSW 18 21093254 missense probably damaging 0.99
R5411:Mep1b UTSW 18 21086249 missense probably damaging 1.00
R6952:Mep1b UTSW 18 21088670 missense probably benign 0.00
R7056:Mep1b UTSW 18 21091190 missense probably damaging 1.00
R7078:Mep1b UTSW 18 21100051 missense probably benign 0.35
R7217:Mep1b UTSW 18 21093543 missense probably benign 0.01
R7641:Mep1b UTSW 18 21094977 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCGGCACCCTTAAGTCAATG -3'
(R):5'- GCCTAGAATCTGTGTGAAATTCTG -3'

Sequencing Primer
(F):5'- ACCTTTCTTCAAATCCATGGGAGGG -3'
(R):5'- GAAATTCTGTATGTGCCAGATATGG -3'
Posted On2014-07-14