Mutagenetix > Incidental Mutation

Incidental Mutation 'R1913:Sdk2'

214598

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

039931-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R1913 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113856726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 653 (S653P)

Ref Sequence

ENSEMBL: ENSMUSP00000116872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]

AlphaFold

Q6V4S5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041627
AA Change: S653P

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: S653P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141943
AA Change: S653P

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: S653P

Domain	Start	End	E-Value	Type
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	889	1.96e1	SMART

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	G	5: 9,266,275	L2R	probably damaging	Het
Abca16	A	T	7: 120,541,240	I1588F	probably benign	Het
Abcc2	A	T	19: 43,807,244	T480S	probably benign	Het
Acnat1	A	G	4: 49,447,498	I361T	probably damaging	Het
Adamts10	A	T	17: 33,549,555	H869L	probably benign	Het
AF366264	T	A	8: 13,837,143	Q316L	probably benign	Het
Agpat5	T	C	8: 18,879,613	C253R	probably benign	Het
Agtrap	T	A	4: 148,083,977	H15L	probably damaging	Het
Ahnak	T	A	19: 9,007,922	V2190E	probably damaging	Het
Alx4	A	G	2: 93,675,387	E278G	probably damaging	Het
Amz2	T	C	11: 109,428,871	S28P	probably damaging	Het
Atr	T	A	9: 95,866,733	Y444N	probably benign	Het
Brdt	T	C	5: 107,348,613	I197T	probably benign	Het
Ccser1	G	T	6: 62,379,894	S772I	probably damaging	Het
Cdh16	T	C	8: 104,616,468	H657R	probably benign	Het
Ceacam5	A	T	7: 17,759,577	K842*	probably null	Het
Cep120	G	A	18: 53,723,286	T353I	probably benign	Het
Chrnb1	T	C	11: 69,793,584	N164S	possibly damaging	Het
Cse1l	T	C	2: 166,922,191	F123L	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dcx	G	C	X: 143,923,103	L231V	probably damaging	Het
Dnah12	T	C	14: 26,792,264		probably null	Het
Dnah2	A	T	11: 69,464,930	M2227K	probably damaging	Het
Dnajc30	G	A	5: 135,064,332	A28T	probably benign	Het
Dnm1l	T	C	16: 16,329,966	T306A	probably benign	Het
Enpp3	C	A	10: 24,776,771	E763*	probably null	Het
Esyt3	T	C	9: 99,320,311	S516G	probably benign	Het
Exoc3	T	C	13: 74,182,316	Q498R	probably damaging	Het
Fbn2	T	A	18: 58,061,742	N1449I	probably damaging	Het
Fgb	T	C	3: 83,044,980	D194G	probably benign	Het
Fgd3	T	C	13: 49,263,848	D713G	possibly damaging	Het
Foxb1	T	A	9: 69,760,101	Y49F	possibly damaging	Het
Fpr3	A	G	17: 17,971,408	I314V	probably damaging	Het
Gfod1	A	T	13: 43,303,445	I18N	probably damaging	Het
Gm11492	T	C	11: 87,567,012	S71P	probably benign	Het
Gm5407	T	C	16: 49,296,920		noncoding transcript	Het
Gm7534	A	G	4: 134,192,675		probably null	Het
Gpr89	A	G	3: 96,875,633	F334L	possibly damaging	Het
Gucy2d	G	T	7: 98,443,847	V144F	probably benign	Het
H2-Bl	T	A	17: 36,081,016	K237M	probably damaging	Het
H2-M10.5	C	A	17: 36,774,768	P273H	probably damaging	Het
Hcn2	A	G	10: 79,730,943	M485V	probably benign	Het
Helz2	G	T	2: 181,233,750	S1650R	probably damaging	Het
Ifnar2	T	C	16: 91,404,170	V433A	probably benign	Het
Igsf21	T	A	4: 140,107,312	Y83F	probably benign	Het
Kcnk18	A	G	19: 59,235,058	I212V	possibly damaging	Het
Kcns2	T	C	15: 34,839,709	I406T	probably damaging	Het
Krt42	C	T	11: 100,267,249	V166M	possibly damaging	Het
Lama3	T	C	18: 12,495,279	M1476T	probably benign	Het
Lcor	A	G	19: 41,558,474	R166G	probably benign	Het
Mapt	C	T	11: 104,328,075	P354L	probably damaging	Het
Mep1b	A	T	18: 21,093,229	I383F	probably benign	Het
Mpzl1	C	A	1: 165,601,805	C222F	probably benign	Het
Mug2	T	C	6: 122,070,870	L780P	probably damaging	Het
Naip2	C	T	13: 100,152,157		probably null	Het
Ndufab1	T	C	7: 122,096,691	D41G	probably benign	Het
Ntn1	A	G	11: 68,213,185	C546R	probably damaging	Het
Olfr448	T	A	6: 42,896,753	F101I	probably damaging	Het
Pakap	A	G	4: 57,892,963	E880G	probably damaging	Het
Pde6b	A	G	5: 108,427,190	E639G	probably benign	Het
Phf10	T	C	17: 14,956,809	T83A	probably benign	Het
Phkb	T	A	8: 85,901,920	I186N	possibly damaging	Het
Pkhd1	A	G	1: 20,566,756		probably null	Het
Plxnd1	C	A	6: 115,978,017	A595S	possibly damaging	Het
Ppara	T	A	15: 85,801,099	H416Q	probably damaging	Het
Prodh	T	A	16: 18,081,027	D188V	probably damaging	Het
Psmd14	A	T	2: 61,785,456	K223M	possibly damaging	Het
Ptpn5	A	G	7: 47,078,868	M528T	possibly damaging	Het
Rassf9	G	A	10: 102,544,939	E59K	probably benign	Het
Rnf2	A	T	1: 151,476,185	L140H	probably damaging	Het
Scai	A	G	2: 39,080,081	F557S	probably damaging	Het
Sec24c	A	G	14: 20,689,111	D534G	probably benign	Het
Serinc1	A	G	10: 57,519,465	V375A	probably benign	Het
Serpinb9f	C	T	13: 33,325,846	A7V	probably damaging	Het
Smco1	T	C	16: 32,273,882	S124P	probably damaging	Het
Smim23	C	A	11: 32,824,441	C26F	possibly damaging	Het
Sppl2c	T	A	11: 104,187,889	M505K	probably benign	Het
Sprr1b	C	A	3: 92,437,468	V34F	possibly damaging	Het
Sun1	G	A	5: 139,235,732		probably null	Het
Supt16	A	G	14: 52,178,135	L381P	possibly damaging	Het
Syne2	A	G	12: 75,899,246	D364G	possibly damaging	Het
Tax1bp1	G	T	6: 52,765,952	V775F	probably damaging	Het
Tial1	T	A	7: 128,444,659	I231F	probably damaging	Het
Tiam1	C	A	16: 89,798,694	V1300L	probably damaging	Het
Tmem132e	A	G	11: 82,443,417	T585A	probably damaging	Het
Tnni3k	C	T	3: 154,979,199	A165T	probably benign	Het
Tomm40	A	T	7: 19,710,961	I165N	probably damaging	Het
Tomt	T	C	7: 101,901,247	E104G	probably damaging	Het
Topaz1	T	C	9: 122,767,013	S950P	possibly damaging	Het
Traf3ip2	C	G	10: 39,625,940	P28R	probably benign	Het
Trim24	C	T	6: 37,957,815	P822S	probably damaging	Het
Upf3a	T	G	8: 13,792,108	Y175D	probably damaging	Het
Vars2	G	A	17: 35,666,922	P69S	probably benign	Het
Veph1	T	C	3: 66,244,555	Y151C	probably damaging	Het
Vmn2r11	T	A	5: 109,054,788	D141V	probably benign	Het
Vwa5b1	G	A	4: 138,592,020	Q442*	probably null	Het
Wdr17	T	A	8: 54,687,726	D197V	probably damaging	Het
Wdr70	G	T	15: 7,884,410	T586N	possibly damaging	Het
Wfdc18	G	A	11: 83,709,928	G52R	probably benign	Het
Zc3h6	T	C	2: 129,016,620	I857T	probably damaging	Het
Zfp318	GAAGAA	GAAGAACAAGAA	17: 46,412,524		probably benign	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp647	C	T	15: 76,911,951	V170I	probably benign	Het
Zfp871	T	C	17: 32,775,917	N76D	possibly damaging	Het
Zwilch	A	G	9: 64,160,952	Y194H	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGGATGCTGCCTTTTCC -3'
(R):5'- GGTAGACTCCATCACATCGC -3'

Sequencing Primer
(F):5'- ACAGGATGCTGCCTTTTCCTTTAAG -3'
(R):5'- CTGGTAAAAGCTTGCTGCC -3'

Posted On

2014-07-14