Incidental Mutation 'R0961:Mep1b'
ID81905
Institutional Source Beutler Lab
Gene Symbol Mep1b
Ensembl Gene ENSMUSG00000024313
Gene Namemeprin 1 beta
SynonymsMep-1b, meprin beta
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location21072344-21100199 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21088729 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 245 (Y245*)
Ref Sequence ENSEMBL: ENSMUSP00000080866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082235]
Predicted Effect probably null
Transcript: ENSMUST00000082235
AA Change: Y245*
SMART Domains Protein: ENSMUSP00000080866
Gene: ENSMUSG00000024313
AA Change: Y245*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 42 N/A INTRINSIC
ZnMc 68 208 1.23e-54 SMART
MAM 261 430 1.91e-52 SMART
MATH 433 569 4.88e-8 SMART
EGF 610 647 2.35e-2 SMART
transmembrane domain 658 680 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit 50% prenatal lethality; survivors have reduced birth weight and show altered renal gene expression, but otherwise are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Mep1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Mep1b APN 18 21084186 nonsense probably null
IGL01470:Mep1b APN 18 21097467 missense probably benign 0.26
IGL01866:Mep1b APN 18 21094993 missense probably benign 0.34
IGL02865:Mep1b APN 18 21093384 missense probably benign 0.02
IGL03093:Mep1b APN 18 21093653 missense probably benign 0.01
IGL03126:Mep1b APN 18 21088560 missense probably damaging 1.00
IGL03196:Mep1b APN 18 21095064 missense probably benign 0.01
P0022:Mep1b UTSW 18 21088541 splice site probably benign
R0143:Mep1b UTSW 18 21095107 splice site probably benign
R0743:Mep1b UTSW 18 21080458 missense possibly damaging 0.81
R1913:Mep1b UTSW 18 21093229 missense probably benign 0.21
R2162:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R2307:Mep1b UTSW 18 21088575 missense probably damaging 1.00
R3000:Mep1b UTSW 18 21093304 missense probably damaging 0.96
R3833:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3862:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3863:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3864:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R4171:Mep1b UTSW 18 21095106 splice site probably null
R4774:Mep1b UTSW 18 21086184 missense probably benign 0.24
R4798:Mep1b UTSW 18 21093254 missense probably damaging 0.99
R5411:Mep1b UTSW 18 21086249 missense probably damaging 1.00
R6952:Mep1b UTSW 18 21088670 missense probably benign 0.00
R7056:Mep1b UTSW 18 21091190 missense probably damaging 1.00
R7078:Mep1b UTSW 18 21100051 missense probably benign 0.35
R7217:Mep1b UTSW 18 21093543 missense probably benign 0.01
R7641:Mep1b UTSW 18 21094977 missense possibly damaging 0.47
R7843:Mep1b UTSW 18 21095053 missense probably damaging 1.00
R7926:Mep1b UTSW 18 21095053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTCTGATTCCCTGAATGTCCC -3'
(R):5'- ACACAGGATGACGTGTGTGAGC -3'

Sequencing Primer
(F):5'- GATTCCCTGAATGTCCCATATGAC -3'
(R):5'- CCCTGCAAGGCAGAAGAAAT -3'
Posted On2013-11-08