Incidental Mutation 'R1913:Vars2'
ID214627
Institutional Source Beutler Lab
Gene Symbol Vars2
Ensembl Gene ENSMUSG00000038838
Gene Namevalyl-tRNA synthetase 2, mitochondrial
SynonymsVars2l
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35655634-35667592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35666922 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 69 (P69S)
Ref Sequence ENSEMBL: ENSMUSP00000047917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144] [ENSMUST00000169093]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000043674
AA Change: P69S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838
AA Change: P69S

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159671
Predicted Effect probably benign
Transcript: ENSMUST00000160039
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect probably benign
Transcript: ENSMUST00000160734
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect probably benign
Transcript: ENSMUST00000164404
SMART Domains Protein: ENSMUSP00000126084
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 201 1e-49 PFAM
Pfam:tRNA-synt_1g 68 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect probably benign
Transcript: ENSMUST00000165144
AA Change: T71I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect probably benign
Transcript: ENSMUST00000168922
SMART Domains Protein: ENSMUSP00000129196
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 2 386 3e-105 PFAM
Pfam:Anticodon_1 430 566 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169093
SMART Domains Protein: ENSMUSP00000126794
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 109 1.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Vars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Vars2 APN 17 35664621 unclassified probably benign
IGL02320:Vars2 APN 17 35660454 missense probably benign 0.07
IGL02580:Vars2 APN 17 35660885 missense possibly damaging 0.50
IGL02691:Vars2 APN 17 35660248 missense probably damaging 1.00
IGL03039:Vars2 APN 17 35664121 missense probably damaging 1.00
PIT4445001:Vars2 UTSW 17 35666211 nonsense probably null
R0079:Vars2 UTSW 17 35659156 missense probably damaging 0.99
R0152:Vars2 UTSW 17 35660027 missense probably damaging 1.00
R0346:Vars2 UTSW 17 35664864 unclassified probably benign
R0426:Vars2 UTSW 17 35664584 missense probably damaging 1.00
R0584:Vars2 UTSW 17 35666686 missense possibly damaging 0.82
R0589:Vars2 UTSW 17 35659176 missense probably benign
R0882:Vars2 UTSW 17 35657299 missense probably benign 0.41
R1234:Vars2 UTSW 17 35667146 missense probably damaging 1.00
R1263:Vars2 UTSW 17 35661609 missense probably damaging 1.00
R1559:Vars2 UTSW 17 35666258 unclassified probably benign
R1772:Vars2 UTSW 17 35660084 missense probably damaging 1.00
R1809:Vars2 UTSW 17 35662216 missense probably damaging 1.00
R1986:Vars2 UTSW 17 35660061 missense probably damaging 1.00
R2504:Vars2 UTSW 17 35664793 missense probably damaging 1.00
R3426:Vars2 UTSW 17 35661974 missense probably damaging 1.00
R4539:Vars2 UTSW 17 35666888 missense probably damaging 0.99
R4751:Vars2 UTSW 17 35659343 missense possibly damaging 0.89
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R5028:Vars2 UTSW 17 35659473 critical splice donor site probably null
R5217:Vars2 UTSW 17 35658149 missense probably damaging 1.00
R5292:Vars2 UTSW 17 35660786 missense probably damaging 1.00
R6056:Vars2 UTSW 17 35665788 missense probably benign 0.01
R6211:Vars2 UTSW 17 35665662 unclassified probably null
R6213:Vars2 UTSW 17 35660440 missense probably benign 0.27
R6374:Vars2 UTSW 17 35660045 missense probably damaging 1.00
R6746:Vars2 UTSW 17 35660402 critical splice donor site probably null
R6749:Vars2 UTSW 17 35666713 missense probably damaging 1.00
R6957:Vars2 UTSW 17 35667075 missense probably benign 0.39
R7107:Vars2 UTSW 17 35658250 missense probably damaging 1.00
R7428:Vars2 UTSW 17 35666686 missense probably benign 0.00
R7538:Vars2 UTSW 17 35660780 missense probably damaging 1.00
R7553:Vars2 UTSW 17 35664788 missense possibly damaging 0.93
X0021:Vars2 UTSW 17 35659034 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGAAACATCTGTGGAAGCAG -3'
(R):5'- CACTTTGTACACAGCCGGAG -3'

Sequencing Primer
(F):5'- GAACAGAGATCCACTACTGAACTG -3'
(R):5'- TCCCCTGTCTCTCGGAGGAAC -3'
Posted On2014-07-14