Mutagenetix > Incidental Mutation

Incidental Mutation 'R1913:Pde6b'

214551

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

MMRRC Submission

039931-MU

Accession Numbers

Genbank: NM_008806; MGI: 97525

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1913 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108427190 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 639 (E639G)

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

AlphaFold

P23440

Predicted Effect

probably benign
Transcript: ENSMUST00000031456
AA Change: E639G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: E639G

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134865

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	G	5: 9,266,275	L2R	probably damaging	Het
Abca16	A	T	7: 120,541,240	I1588F	probably benign	Het
Abcc2	A	T	19: 43,807,244	T480S	probably benign	Het
Acnat1	A	G	4: 49,447,498	I361T	probably damaging	Het
Adamts10	A	T	17: 33,549,555	H869L	probably benign	Het
AF366264	T	A	8: 13,837,143	Q316L	probably benign	Het
Agpat5	T	C	8: 18,879,613	C253R	probably benign	Het
Agtrap	T	A	4: 148,083,977	H15L	probably damaging	Het
Ahnak	T	A	19: 9,007,922	V2190E	probably damaging	Het
Alx4	A	G	2: 93,675,387	E278G	probably damaging	Het
Amz2	T	C	11: 109,428,871	S28P	probably damaging	Het
Atr	T	A	9: 95,866,733	Y444N	probably benign	Het
Brdt	T	C	5: 107,348,613	I197T	probably benign	Het
Ccser1	G	T	6: 62,379,894	S772I	probably damaging	Het
Cdh16	T	C	8: 104,616,468	H657R	probably benign	Het
Ceacam5	A	T	7: 17,759,577	K842*	probably null	Het
Cep120	G	A	18: 53,723,286	T353I	probably benign	Het
Chrnb1	T	C	11: 69,793,584	N164S	possibly damaging	Het
Cse1l	T	C	2: 166,922,191	F123L	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dcx	G	C	X: 143,923,103	L231V	probably damaging	Het
Dnah12	T	C	14: 26,792,264		probably null	Het
Dnah2	A	T	11: 69,464,930	M2227K	probably damaging	Het
Dnajc30	G	A	5: 135,064,332	A28T	probably benign	Het
Dnm1l	T	C	16: 16,329,966	T306A	probably benign	Het
Enpp3	C	A	10: 24,776,771	E763*	probably null	Het
Esyt3	T	C	9: 99,320,311	S516G	probably benign	Het
Exoc3	T	C	13: 74,182,316	Q498R	probably damaging	Het
Fbn2	T	A	18: 58,061,742	N1449I	probably damaging	Het
Fgb	T	C	3: 83,044,980	D194G	probably benign	Het
Fgd3	T	C	13: 49,263,848	D713G	possibly damaging	Het
Foxb1	T	A	9: 69,760,101	Y49F	possibly damaging	Het
Fpr3	A	G	17: 17,971,408	I314V	probably damaging	Het
Gfod1	A	T	13: 43,303,445	I18N	probably damaging	Het
Gm11492	T	C	11: 87,567,012	S71P	probably benign	Het
Gm5407	T	C	16: 49,296,920		noncoding transcript	Het
Gm7534	A	G	4: 134,192,675		probably null	Het
Gpr89	A	G	3: 96,875,633	F334L	possibly damaging	Het
Gucy2d	G	T	7: 98,443,847	V144F	probably benign	Het
H2-Bl	T	A	17: 36,081,016	K237M	probably damaging	Het
H2-M10.5	C	A	17: 36,774,768	P273H	probably damaging	Het
Hcn2	A	G	10: 79,730,943	M485V	probably benign	Het
Helz2	G	T	2: 181,233,750	S1650R	probably damaging	Het
Ifnar2	T	C	16: 91,404,170	V433A	probably benign	Het
Igsf21	T	A	4: 140,107,312	Y83F	probably benign	Het
Kcnk18	A	G	19: 59,235,058	I212V	possibly damaging	Het
Kcns2	T	C	15: 34,839,709	I406T	probably damaging	Het
Krt42	C	T	11: 100,267,249	V166M	possibly damaging	Het
Lama3	T	C	18: 12,495,279	M1476T	probably benign	Het
Lcor	A	G	19: 41,558,474	R166G	probably benign	Het
Mapt	C	T	11: 104,328,075	P354L	probably damaging	Het
Mep1b	A	T	18: 21,093,229	I383F	probably benign	Het
Mpzl1	C	A	1: 165,601,805	C222F	probably benign	Het
Mug2	T	C	6: 122,070,870	L780P	probably damaging	Het
Naip2	C	T	13: 100,152,157		probably null	Het
Ndufab1	T	C	7: 122,096,691	D41G	probably benign	Het
Ntn1	A	G	11: 68,213,185	C546R	probably damaging	Het
Olfr448	T	A	6: 42,896,753	F101I	probably damaging	Het
Pakap	A	G	4: 57,892,963	E880G	probably damaging	Het
Phf10	T	C	17: 14,956,809	T83A	probably benign	Het
Phkb	T	A	8: 85,901,920	I186N	possibly damaging	Het
Pkhd1	A	G	1: 20,566,756		probably null	Het
Plxnd1	C	A	6: 115,978,017	A595S	possibly damaging	Het
Ppara	T	A	15: 85,801,099	H416Q	probably damaging	Het
Prodh	T	A	16: 18,081,027	D188V	probably damaging	Het
Psmd14	A	T	2: 61,785,456	K223M	possibly damaging	Het
Ptpn5	A	G	7: 47,078,868	M528T	possibly damaging	Het
Rassf9	G	A	10: 102,544,939	E59K	probably benign	Het
Rnf2	A	T	1: 151,476,185	L140H	probably damaging	Het
Scai	A	G	2: 39,080,081	F557S	probably damaging	Het
Sdk2	A	G	11: 113,856,726	S653P	possibly damaging	Het
Sec24c	A	G	14: 20,689,111	D534G	probably benign	Het
Serinc1	A	G	10: 57,519,465	V375A	probably benign	Het
Serpinb9f	C	T	13: 33,325,846	A7V	probably damaging	Het
Smco1	T	C	16: 32,273,882	S124P	probably damaging	Het
Smim23	C	A	11: 32,824,441	C26F	possibly damaging	Het
Sppl2c	T	A	11: 104,187,889	M505K	probably benign	Het
Sprr1b	C	A	3: 92,437,468	V34F	possibly damaging	Het
Sun1	G	A	5: 139,235,732		probably null	Het
Supt16	A	G	14: 52,178,135	L381P	possibly damaging	Het
Syne2	A	G	12: 75,899,246	D364G	possibly damaging	Het
Tax1bp1	G	T	6: 52,765,952	V775F	probably damaging	Het
Tial1	T	A	7: 128,444,659	I231F	probably damaging	Het
Tiam1	C	A	16: 89,798,694	V1300L	probably damaging	Het
Tmem132e	A	G	11: 82,443,417	T585A	probably damaging	Het
Tnni3k	C	T	3: 154,979,199	A165T	probably benign	Het
Tomm40	A	T	7: 19,710,961	I165N	probably damaging	Het
Tomt	T	C	7: 101,901,247	E104G	probably damaging	Het
Topaz1	T	C	9: 122,767,013	S950P	possibly damaging	Het
Traf3ip2	C	G	10: 39,625,940	P28R	probably benign	Het
Trim24	C	T	6: 37,957,815	P822S	probably damaging	Het
Upf3a	T	G	8: 13,792,108	Y175D	probably damaging	Het
Vars2	G	A	17: 35,666,922	P69S	probably benign	Het
Veph1	T	C	3: 66,244,555	Y151C	probably damaging	Het
Vmn2r11	T	A	5: 109,054,788	D141V	probably benign	Het
Vwa5b1	G	A	4: 138,592,020	Q442*	probably null	Het
Wdr17	T	A	8: 54,687,726	D197V	probably damaging	Het
Wdr70	G	T	15: 7,884,410	T586N	possibly damaging	Het
Wfdc18	G	A	11: 83,709,928	G52R	probably benign	Het
Zc3h6	T	C	2: 129,016,620	I857T	probably damaging	Het
Zfp318	GAAGAA	GAAGAACAAGAA	17: 46,412,524		probably benign	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp647	C	T	15: 76,911,951	V170I	probably benign	Het
Zfp871	T	C	17: 32,775,917	N76D	possibly damaging	Het
Zwilch	A	G	9: 64,160,952	Y194H	probably damaging	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4362001:Pde6b	UTSW	5	108423585	critical splice donor site	probably null
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1801:Pde6b	UTSW	5	108427847	missense	possibly damaging	0.51
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4972:Pde6b	UTSW	5	108425264	missense	probably benign	0.00
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5528:Pde6b	UTSW	5	108423558	missense	probably benign	0.04
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R7937:Pde6b	UTSW	5	108419773	critical splice donor site	probably null
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00
R8698:Pde6b	UTSW	5	108428239	missense	possibly damaging	0.87
R8822:Pde6b	UTSW	5	108403462	missense	probably benign	0.00
R8985:Pde6b	UTSW	5	108430637	missense	probably benign	0.02
R9016:Pde6b	UTSW	5	108388726	missense	possibly damaging	0.88
R9292:Pde6b	UTSW	5	108388885	missense	probably benign	0.00
R9323:Pde6b	UTSW	5	108403432	missense	probably damaging	1.00
R9414:Pde6b	UTSW	5	108419726	missense	possibly damaging	0.82
R9486:Pde6b	UTSW	5	108403375	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGCAGTCTGGCAATCAGTACTG -3'
(R):5'- GTACCCTCTAGTGGCCATTC -3'

Sequencing Primer
(F):5'- TCAGTACTGAGATGGACCACCTTG -3'
(R):5'- GTGGCCATTCCTAGCTACTG -3'

Posted On

2014-07-14