Incidental Mutation 'R1928:Zcchc6'
ID215092
Institutional Source Beutler Lab
Gene Symbol Zcchc6
Ensembl Gene ENSMUSG00000035248
Gene Namezinc finger, CCHC domain containing 6
Synonyms6030448M23Rik
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59771561-59823147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59816734 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 209 (L209P)
Ref Sequence ENSEMBL: ENSMUSP00000071623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000225179] [ENSMUST00000225576]
Predicted Effect probably damaging
Transcript: ENSMUST00000071703
AA Change: L209P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: L209P

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
ZnF_C2H2 244 268 2.61e1 SMART
SCOP:d1f5aa2 284 497 4e-25 SMART
low complexity region 522 534 N/A INTRINSIC
Pfam:PAP_assoc 550 603 6.7e-14 PFAM
low complexity region 811 825 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 882 898 N/A INTRINSIC
ZnF_C2HC 960 976 3.3e-3 SMART
Pfam:NTP_transf_2 1022 1134 4e-8 PFAM
Pfam:PAP_assoc 1229 1282 1.7e-17 PFAM
ZnF_C2HC 1342 1358 2.09e-3 SMART
Pfam:TUTF7_u4 1359 1446 1.6e-42 PFAM
ZnF_C2HC 1448 1464 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225179
Predicted Effect probably benign
Transcript: ENSMUST00000225576
Meta Mutation Damage Score 0.2107 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Zcchc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Zcchc6 APN 13 59816698 missense probably damaging 1.00
IGL01361:Zcchc6 APN 13 59785800 missense probably damaging 1.00
IGL02002:Zcchc6 APN 13 59782096 missense possibly damaging 0.76
IGL02015:Zcchc6 APN 13 59789258 missense probably damaging 1.00
IGL02029:Zcchc6 APN 13 59784888 unclassified probably benign
IGL02216:Zcchc6 APN 13 59800423 missense probably benign 0.01
IGL02705:Zcchc6 APN 13 59789203 missense probably damaging 1.00
IGL02742:Zcchc6 APN 13 59816342 missense probably damaging 0.99
IGL02810:Zcchc6 APN 13 59782016 critical splice donor site probably null
IGL02942:Zcchc6 APN 13 59811521 missense probably damaging 0.98
IGL03104:Zcchc6 APN 13 59814903 missense probably benign 0.04
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0153:Zcchc6 UTSW 13 59782336 nonsense probably null
R0269:Zcchc6 UTSW 13 59816855 splice site probably null
R0358:Zcchc6 UTSW 13 59782104 missense probably damaging 0.99
R0555:Zcchc6 UTSW 13 59800317 missense probably benign 0.00
R0599:Zcchc6 UTSW 13 59809487 missense probably damaging 1.00
R0609:Zcchc6 UTSW 13 59799782 nonsense probably null
R0617:Zcchc6 UTSW 13 59816855 splice site probably null
R0680:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R0699:Zcchc6 UTSW 13 59782014 splice site probably benign
R1214:Zcchc6 UTSW 13 59805326 missense possibly damaging 0.76
R1271:Zcchc6 UTSW 13 59821855 missense probably damaging 0.99
R1556:Zcchc6 UTSW 13 59800240 missense probably benign 0.02
R1662:Zcchc6 UTSW 13 59799903 missense possibly damaging 0.93
R1777:Zcchc6 UTSW 13 59791821 missense probably damaging 1.00
R1834:Zcchc6 UTSW 13 59814935 nonsense probably null
R2012:Zcchc6 UTSW 13 59811538 missense probably damaging 0.99
R2045:Zcchc6 UTSW 13 59800656 missense probably damaging 1.00
R2336:Zcchc6 UTSW 13 59799054 missense probably damaging 1.00
R3764:Zcchc6 UTSW 13 59800380 missense probably damaging 0.98
R3899:Zcchc6 UTSW 13 59789255 nonsense probably null
R3918:Zcchc6 UTSW 13 59782024 missense probably damaging 1.00
R4423:Zcchc6 UTSW 13 59822049 missense probably damaging 0.96
R4664:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R4673:Zcchc6 UTSW 13 59796845 missense probably damaging 1.00
R4770:Zcchc6 UTSW 13 59772884 unclassified probably benign
R4884:Zcchc6 UTSW 13 59789452 missense probably damaging 1.00
R5186:Zcchc6 UTSW 13 59816656 critical splice donor site probably null
R5337:Zcchc6 UTSW 13 59791852 missense probably damaging 1.00
R5385:Zcchc6 UTSW 13 59789846 critical splice donor site probably null
R5452:Zcchc6 UTSW 13 59800657 missense probably damaging 1.00
R5534:Zcchc6 UTSW 13 59788553 missense probably damaging 1.00
R5566:Zcchc6 UTSW 13 59788629 nonsense probably null
R5928:Zcchc6 UTSW 13 59822066 missense probably benign 0.16
R5994:Zcchc6 UTSW 13 59789209 missense probably damaging 1.00
R6415:Zcchc6 UTSW 13 59816296 splice site probably null
R6495:Zcchc6 UTSW 13 59799939 missense possibly damaging 0.95
R6577:Zcchc6 UTSW 13 59808161 missense probably damaging 1.00
R7205:Zcchc6 UTSW 13 59788550 missense probably damaging 1.00
R7286:Zcchc6 UTSW 13 59821649 missense probably benign 0.18
R7355:Zcchc6 UTSW 13 59821802 missense probably benign 0.00
R7369:Zcchc6 UTSW 13 59782053 missense possibly damaging 0.71
R7455:Zcchc6 UTSW 13 59822057 missense probably benign 0.03
R7557:Zcchc6 UTSW 13 59788466 missense possibly damaging 0.89
R7635:Zcchc6 UTSW 13 59800090 missense probably benign 0.03
R7727:Zcchc6 UTSW 13 59799682 missense probably benign 0.00
R7798:Zcchc6 UTSW 13 59815575 missense possibly damaging 0.81
R7912:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R7915:Zcchc6 UTSW 13 59784814 missense probably benign 0.12
R8035:Zcchc6 UTSW 13 59789190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAAAGCCTAACCCTGAGG -3'
(R):5'- TCTTTGTTCAGTGTTCAGGTATCAC -3'

Sequencing Primer
(F):5'- GCACATACTGCAGTTACTAACTTGG -3'
(R):5'- TGAGGACCTGGGTTCAATACC -3'
Posted On2014-07-14