Incidental Mutation 'R6275:Stac3'
ID 507587
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene Name SH3 and cysteine rich domain 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6275 (G1)
Quality Score 216.009
Status Validated
Chromosome 10
Chromosomal Location 127501686-127508823 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 127507746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 252 (Y252*)
Ref Sequence ENSEMBL: ENSMUSP00000125124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000160019] [ENSMUST00000160610]
AlphaFold Q8BZ71
Predicted Effect probably null
Transcript: ENSMUST00000035839
AA Change: Y252*
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: Y252*

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160019
AA Change: Y252*
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: Y252*

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rnf38 T A 4: 44,152,408 H52L probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127503664 missense probably damaging 1.00
IGL02271:Stac3 APN 10 127503899 missense probably benign 0.00
R0051:Stac3 UTSW 10 127508148 missense probably damaging 0.98
R0090:Stac3 UTSW 10 127503930 unclassified probably benign
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0132:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0330:Stac3 UTSW 10 127507747 splice site probably null
R0630:Stac3 UTSW 10 127507763 missense probably damaging 1.00
R1132:Stac3 UTSW 10 127507259 missense probably benign
R1450:Stac3 UTSW 10 127504885 missense probably damaging 1.00
R1739:Stac3 UTSW 10 127507766 missense probably benign 0.40
R2316:Stac3 UTSW 10 127503360 splice site probably null
R2511:Stac3 UTSW 10 127503918 critical splice donor site probably null
R3000:Stac3 UTSW 10 127508147 missense probably benign 0.01
R4324:Stac3 UTSW 10 127503249 missense probably damaging 0.99
R4758:Stac3 UTSW 10 127503345 missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127508124 missense probably damaging 0.98
R6244:Stac3 UTSW 10 127508175 missense probably damaging 1.00
R7335:Stac3 UTSW 10 127504900 missense probably benign 0.22
R8191:Stac3 UTSW 10 127508199 missense probably damaging 1.00
R8290:Stac3 UTSW 10 127503360 splice site probably null
R8410:Stac3 UTSW 10 127503330 missense probably damaging 1.00
R8690:Stac3 UTSW 10 127503625 missense probably damaging 1.00
R8799:Stac3 UTSW 10 127504912 missense probably damaging 0.98
R9008:Stac3 UTSW 10 127503585 missense probably damaging 1.00
R9095:Stac3 UTSW 10 127507715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCTTCCTCCCTGTAGAAC -3'
(R):5'- GATTTACAGTCACATGCCCGTG -3'

Sequencing Primer
(F):5'- TGTAGAACCCTGGTCCTCG -3'
(R):5'- TCACATGCCCGTGCCTGG -3'
Posted On 2018-03-15