Mutagenetix > Incidental Mutations

Incidental Mutation 'R6275:Stac3'

507587

Institutional Source

Beutler Lab

Gene Symbol

Stac3

Ensembl Gene

ENSMUSG00000040287

Gene Name

SH3 and cysteine rich domain 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6275 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

127501686-127508823 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 127507746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 252 (Y252*)

Ref Sequence

ENSEMBL: ENSMUSP00000125124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000160019] [ENSMUST00000160610]

AlphaFold

Q8BZ71

Predicted Effect

probably null
Transcript: ENSMUST00000035839
AA Change: Y252*

SMART Domains

Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: Y252*

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160019
AA Change: Y252*

SMART Domains

Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: Y252*

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162302

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.4%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,285,368	D3936G	probably damaging	Het
Abca7	T	A	10: 79,997,791	L30H	probably damaging	Het
Abcb6	T	C	1: 75,172,551		probably null	Het
Acsbg1	T	A	9: 54,609,772	M586L	probably benign	Het
Ano6	A	T	15: 95,913,433	Y159F	probably damaging	Het
C1ql1	A	G	11: 102,939,749	I254T	probably damaging	Het
Ccdc81	T	C	7: 89,882,311	D318G	possibly damaging	Het
Ccr7	C	T	11: 99,145,663	M144I	probably damaging	Het
Cdca3	C	T	6: 124,832,664		probably null	Het
Ces1h	A	T	8: 93,372,646	L93I	probably benign	Het
Cntfr	T	C	4: 41,663,216	D197G	possibly damaging	Het
Cyp2d12	C	A	15: 82,556,658	P126T	probably benign	Het
Dnah10	A	G	5: 124,785,184	T2225A	probably damaging	Het
Edrf1	A	T	7: 133,667,582	N1147Y	possibly damaging	Het
Ermap	C	T	4: 119,178,550	V414M	probably damaging	Het
Fam13a	A	G	6: 58,954,257	I446T	probably damaging	Het
Fgfbp3	T	C	19: 36,918,753	H155R	possibly damaging	Het
Folr1	T	A	7: 101,859,535	N61I	probably damaging	Het
Fsip1	T	C	2: 118,205,102	I431V	probably benign	Het
Gm5039	T	C	12: 88,321,225	D86G	possibly damaging	Het
Gm5493	A	T	17: 22,750,070	E74D	probably benign	Het
Gm6803	T	C	12: 88,018,485	N96S	probably benign	Het
H2-Oa	A	G	17: 34,094,566	D197G	probably benign	Het
Hps1	T	C	19: 42,769,607	E169G	probably null	Het
Il17rc	A	T	6: 113,480,347	M372L	probably benign	Het
Itga10	A	G	3: 96,658,185	S1042G	probably benign	Het
Jchain	A	T	5: 88,521,353	V147E	probably damaging	Het
Laptm4b	A	G	15: 34,283,327	T211A	probably benign	Het
Mal2	T	C	15: 54,571,639		probably null	Het
Mov10l1	T	A	15: 89,026,620	I1071N	probably damaging	Het
Mpp2	T	A	11: 102,060,969	Y401F	probably damaging	Het
Myh15	A	G	16: 49,145,247	T1172A	probably benign	Het
Olfr635	T	A	7: 103,979,974	S261T	probably damaging	Het
Pcnx	G	T	12: 81,918,607	S516I	probably benign	Het
Pidd1	C	T	7: 141,439,795	A685T	probably damaging	Het
Psg28	A	C	7: 18,430,440	Y116D	probably damaging	Het
Psmd11	T	C	11: 80,438,632		probably benign	Het
Rapgefl1	T	A	11: 98,851,120	Y637N	probably damaging	Het
Rbm25	T	A	12: 83,644,432	M66K	probably damaging	Het
Rnf38	T	A	4: 44,152,408	H52L	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,923		probably benign	Het
Sec62	A	G	3: 30,809,836	Q89R	probably damaging	Het
Serpina6	T	A	12: 103,648,720	Q289L	probably benign	Het
Sf3b2	A	C	19: 5,283,650	I640S	probably damaging	Het
Slc13a2	CGTTATCTGT	CGT	11: 78,403,480		probably benign	Het
Slc26a11	T	C	11: 119,359,299	F127L	probably benign	Het
Stoml3	G	A	3: 53,507,506	A240T	probably damaging	Het
Tanc1	A	T	2: 59,843,510	H1653L	probably benign	Het
Tll1	A	T	8: 64,051,367	L665*	probably null	Het
Tnr	A	C	1: 159,861,270	Q434P	probably damaging	Het
Tpgs1	C	A	10: 79,675,520	D165E	probably benign	Het
Tsc2	A	G	17: 24,600,420	V1185A	probably benign	Het
Tulp4	A	G	17: 6,198,736	H203R	probably damaging	Het
Txnl4a	T	A	18: 80,218,765	M72K	possibly damaging	Het
Usp42	G	A	5: 143,714,972	R1099W	probably damaging	Het
Zfp292	G	A	4: 34,808,883	A1387V	possibly damaging	Het
Zfp994	A	T	17: 22,199,991	L659*	probably null	Het

Other mutations in Stac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Stac3	APN	10	127503664	missense	probably damaging	1.00
IGL02271:Stac3	APN	10	127503899	missense	probably benign	0.00
R0051:Stac3	UTSW	10	127508148	missense	probably damaging	0.98
R0090:Stac3	UTSW	10	127503930	unclassified	probably benign
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0132:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0330:Stac3	UTSW	10	127507747	splice site	probably null
R0630:Stac3	UTSW	10	127507763	missense	probably damaging	1.00
R1132:Stac3	UTSW	10	127507259	missense	probably benign
R1450:Stac3	UTSW	10	127504885	missense	probably damaging	1.00
R1739:Stac3	UTSW	10	127507766	missense	probably benign	0.40
R2316:Stac3	UTSW	10	127503360	splice site	probably null
R2511:Stac3	UTSW	10	127503918	critical splice donor site	probably null
R3000:Stac3	UTSW	10	127508147	missense	probably benign	0.01
R4324:Stac3	UTSW	10	127503249	missense	probably damaging	0.99
R4758:Stac3	UTSW	10	127503345	missense	possibly damaging	0.95
R5040:Stac3	UTSW	10	127508124	missense	probably damaging	0.98
R6244:Stac3	UTSW	10	127508175	missense	probably damaging	1.00
R7335:Stac3	UTSW	10	127504900	missense	probably benign	0.22
R8191:Stac3	UTSW	10	127508199	missense	probably damaging	1.00
R8290:Stac3	UTSW	10	127503360	splice site	probably null
R8410:Stac3	UTSW	10	127503330	missense	probably damaging	1.00
R8690:Stac3	UTSW	10	127503625	missense	probably damaging	1.00
R8799:Stac3	UTSW	10	127504912	missense	probably damaging	0.98
R9008:Stac3	UTSW	10	127503585	missense	probably damaging	1.00
R9095:Stac3	UTSW	10	127507715	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCCTTCCTCCCTGTAGAAC -3'
(R):5'- GATTTACAGTCACATGCCCGTG -3'

Sequencing Primer
(F):5'- TGTAGAACCCTGGTCCTCG -3'
(R):5'- TCACATGCCCGTGCCTGG -3'

Posted On

2018-03-15