Incidental Mutation 'R2139:Dhcr24'
ID236029
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 040142-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R2139 (G1)
Quality Score119
Status Not validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 106572302 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 191 (E191*)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
Predicted Effect probably null
Transcript: ENSMUST00000047973
AA Change: E191*
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: E191*

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,295 F318I probably damaging Het
Bfsp2 T C 9: 103,449,875 K221R probably benign Het
Cacna1b A C 2: 24,679,473 M813R probably benign Het
Chaf1a T C 17: 56,065,226 L798P probably damaging Het
Chd8 G A 14: 52,236,971 T201I probably benign Het
Col23a1 T C 11: 51,574,034 S436P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Cyp4f39 A G 17: 32,491,189 I440M probably benign Het
Dlg5 T C 14: 24,170,544 D522G probably damaging Het
Dnaja4 A T 9: 54,709,222 M170L probably benign Het
Dopey2 T C 16: 93,771,007 S1441P possibly damaging Het
Egr2 T A 10: 67,540,872 S383T probably damaging Het
Elovl1 A G 4: 118,431,106 D94G probably damaging Het
Erbb4 A G 1: 68,346,629 V267A probably damaging Het
Esp38 T A 17: 39,953,384 I11N probably damaging Het
Esrrb T C 12: 86,421,966 probably null Het
Fbxo24 A T 5: 137,613,065 S488T probably damaging Het
Fgfr1 T G 8: 25,570,866 V618G probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gpr61 A T 3: 108,150,761 C195S probably damaging Het
Greb1l A C 18: 10,555,011 N1686H probably damaging Het
Hapln4 T C 8: 70,088,138 F274L probably benign Het
Hoxc10 A T 15: 102,967,477 Q207L probably benign Het
Hspa12a A G 19: 58,799,482 V636A probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Kif13a T C 13: 46,752,469 D666G possibly damaging Het
Krt86 A T 15: 101,473,758 I70F probably benign Het
Lgi4 A T 7: 31,063,123 I112F probably damaging Het
Lrrc8c T G 5: 105,606,692 I111S probably damaging Het
Ltbp2 T C 12: 84,815,979 N600S probably damaging Het
Marc1 G A 1: 184,795,435 T276I probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mroh5 T A 15: 73,790,091 D417V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Muc4 T A 16: 32,761,225 I2488N unknown Het
Myrf C G 19: 10,216,467 A532P probably damaging Het
Nav3 T C 10: 109,853,135 N427S probably benign Het
Neb T C 2: 52,212,588 S4315G probably damaging Het
Nyap2 A G 1: 81,241,268 D335G probably damaging Het
Olfm4 T C 14: 80,014,315 L225P probably benign Het
Olfr1199 T A 2: 88,756,093 N194I probably damaging Het
Olfr283 T C 15: 98,378,264 N282S probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Olfr616 A T 7: 103,564,754 I175K possibly damaging Het
Pcdhac2 T G 18: 37,146,086 Y706* probably null Het
Pgbd1 A G 13: 21,423,020 S335P probably damaging Het
Pkhd1l1 A C 15: 44,529,818 I1850L possibly damaging Het
Pogz T C 3: 94,871,007 V304A possibly damaging Het
Rap1a T C 3: 105,739,540 I100V probably damaging Het
Slc4a4 A T 5: 89,046,264 K201M probably damaging Het
Slc6a1 T C 6: 114,304,061 F8S possibly damaging Het
St18 T G 1: 6,810,615 M444R possibly damaging Het
Syna G T 5: 134,559,252 S281* probably null Het
Tgm1 A G 14: 55,709,543 V336A probably damaging Het
Tle6 G T 10: 81,594,034 T400K probably damaging Het
Tmem181a T C 17: 6,298,206 W328R probably damaging Het
Trim7 T C 11: 48,838,894 F193L probably benign Het
Txndc16 A T 14: 45,172,589 M178K probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r74 A G 7: 11,847,316 Y181C probably damaging Het
Vmn2r56 T A 7: 12,712,963 K421* probably null Het
Vwa7 T G 17: 35,023,430 S503R probably benign Het
Washc5 G A 15: 59,350,142 T135M probably damaging Het
Wdr6 T C 9: 108,574,123 I854V probably benign Het
Zfp507 A G 7: 35,793,723 C632R probably damaging Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
R8012:Dhcr24 UTSW 4 106586656 missense probably damaging 1.00
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGATGGATGGGGAATGTCC -3'
(R):5'- GAGCTAGTTATCCTTCATCCGG -3'

Sequencing Primer
(F):5'- GGGAATGTCCTATCTTAGCAGCC -3'
(R):5'- CACCGTAATGTGTACAACGTG -3'
Posted On2014-10-01