Incidental Mutation 'R2188:Abca7'
ID237933
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80002533 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 547 (L547P)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043866
AA Change: L547P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: L547P

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132517
AA Change: L547P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: L547P

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171637
AA Change: L547P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: L547P

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R1911:Abca7 UTSW 10 80006634 missense probably benign 0.17
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6256:Abca7 UTSW 10 80002622 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7493:Abca7 UTSW 10 80002062 missense probably damaging 0.96
R7535:Abca7 UTSW 10 80001629 missense probably benign 0.04
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TAGACTGGATCAGCGCTCCAAG -3'
(R):5'- GGATCCCTCACCTTAAGCAC -3'

Sequencing Primer
(F):5'- TCCAAGGCTGCTGCAGAG -3'
(R):5'- GGATCCCTCACCTTAAGCACTAATAC -3'
Posted On2014-10-02