Incidental Mutation 'R2281:Cyp27b1'
ID243143
Institutional Source Beutler Lab
Gene Symbol Cyp27b1
Ensembl Gene ENSMUSG00000006724
Gene Namecytochrome P450, family 27, subfamily b, polypeptide 1
SynonymsCyp27b, Vdd1, 25(OH)D 1alpha-hydroxylase, 1alpha(OH)ase, P450VD1alpha, 25-hydroxyvitamin D3 1alpha-hydroxylase, Cyp40, Cp2b, Cyp1, VddrI, Pddr, P450c1, Vddr
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2281 (G1)
Quality Score220
Status Not validated
Chromosome10
Chromosomal Location127048250-127053006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127048294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 5 (V5G)
Ref Sequence ENSEMBL: ENSMUSP00000127367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006915] [ENSMUST00000120542] [ENSMUST00000165764] [ENSMUST00000172069]
Predicted Effect probably benign
Transcript: ENSMUST00000006915
SMART Domains Protein: ENSMUSP00000006915
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
Pfam:Methyltransf_4 70 248 3.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120542
SMART Domains Protein: ENSMUSP00000113030
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
Pfam:Methyltransf_4 29 191 3.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135655
Predicted Effect probably benign
Transcript: ENSMUST00000139486
SMART Domains Protein: ENSMUSP00000118885
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
PDB:3CKK|A 24 85 3e-34 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000165764
AA Change: V5G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130005
Gene: ENSMUSG00000006724
AA Change: V5G

DomainStartEndE-ValueType
Pfam:p450 40 504 7.1e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171868
Predicted Effect probably damaging
Transcript: ENSMUST00000172069
AA Change: V5G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the inner mitochondrial membrane where it hydroxylates 25-hydroxyvitamin D3 at the 1alpha position. This reaction synthesizes 1alpha,25-dihydroxyvitamin D3, the active form of vitamin D3, which binds to the vitamin D receptor and regulates calcium metabolism. Thus this enzyme regulates the level of biologically active vitamin D and plays an important role in calcium homeostasis. Mutations in this gene can result in vitamin D-dependent rickets type I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit hypocalcemia, hyperparathyroidism, retarded growth, enlarged lymph nodes, and rickets. Females have uterine hypoplasia and lack corpora lutea, resulting in infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Cyp27b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyp27b1 APN 10 127049682 missense probably benign 0.19
IGL01147:Cyp27b1 APN 10 127050386 missense possibly damaging 0.94
IGL02370:Cyp27b1 APN 10 127050674 splice site probably benign
IGL02670:Cyp27b1 APN 10 127050358 missense probably benign 0.01
IGL02671:Cyp27b1 APN 10 127051043 unclassified probably null
R0483:Cyp27b1 UTSW 10 127050157 missense probably benign 0.02
R0517:Cyp27b1 UTSW 10 127050116 unclassified probably null
R0645:Cyp27b1 UTSW 10 127049098 missense probably benign 0.02
R1479:Cyp27b1 UTSW 10 127051711 critical splice donor site probably null
R1491:Cyp27b1 UTSW 10 127051088 missense probably damaging 0.98
R1830:Cyp27b1 UTSW 10 127049083 missense possibly damaging 0.92
R1929:Cyp27b1 UTSW 10 127048312 missense probably damaging 1.00
R2162:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R2291:Cyp27b1 UTSW 10 127048294 missense possibly damaging 0.80
R3831:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R3832:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R3833:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R4306:Cyp27b1 UTSW 10 127051088 missense probably benign 0.21
R5213:Cyp27b1 UTSW 10 127052095 missense probably damaging 1.00
R5405:Cyp27b1 UTSW 10 127050386 missense possibly damaging 0.94
R5463:Cyp27b1 UTSW 10 127052097 missense possibly damaging 0.89
R5906:Cyp27b1 UTSW 10 127048398 missense probably damaging 1.00
R6181:Cyp27b1 UTSW 10 127050410 missense probably damaging 1.00
R6515:Cyp27b1 UTSW 10 127048250 start gained probably benign
R7249:Cyp27b1 UTSW 10 127051049 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGGGTGCTGAGCTACAC -3'
(R):5'- TGCCATTAAAGCCGGCTCTC -3'

Sequencing Primer
(F):5'- TGCTGAGCTACACAGACCACTTG -3'
(R):5'- TCCTACCAAGGGCAAGGACTG -3'
Posted On2014-10-16