Incidental Mutation 'R2356:Nbn'
ID246916
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission 040338-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2356 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15970863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 282 (I282N)
Ref Sequence ENSEMBL: ENSMUSP00000120829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: I282N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: I282N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118701
Predicted Effect probably damaging
Transcript: ENSMUST00000149069
AA Change: I282N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: I282N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,955 V4407A possibly damaging Het
Abcf3 G T 16: 20,560,499 R705L probably benign Het
Adcy6 A T 15: 98,597,016 probably null Het
Ank1 A T 8: 23,085,672 T145S probably damaging Het
Aph1a T C 3: 95,894,232 F21S probably benign Het
Apoa5 T A 9: 46,270,043 V139E probably damaging Het
Arhgap44 T C 11: 65,010,025 K595R probably damaging Het
Arhgap5 C T 12: 52,519,147 P967L probably benign Het
Atp13a5 A T 16: 29,281,069 I683N probably damaging Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cdk10 T C 8: 123,229,169 V199A probably damaging Het
Ces2h G A 8: 105,015,938 C94Y probably damaging Het
Clcn1 G A 6: 42,291,625 G155D probably damaging Het
Cxcr4 A G 1: 128,589,514 Y135H probably damaging Het
Dapp1 A G 3: 137,937,749 V184A possibly damaging Het
Dhrs7 A C 12: 72,652,381 S276A probably benign Het
Dlg5 A G 14: 24,170,428 probably null Het
Dnaaf1 T A 8: 119,588,287 F278Y probably damaging Het
Dnaaf2 A G 12: 69,198,218 F23S probably benign Het
En2 G T 5: 28,166,332 probably benign Het
Erbb4 T A 1: 68,078,596 M887L probably benign Het
Exoc5 T C 14: 49,016,281 M482V probably benign Het
Foxk1 A G 5: 142,455,409 I571V possibly damaging Het
Fry G A 5: 150,471,432 G650D probably benign Het
Gm8225 T C 17: 26,543,404 S190P probably damaging Het
Gm9573 A G 17: 35,621,671 probably benign Het
Gpx5 G C 13: 21,291,368 H63D possibly damaging Het
Ipo9 A T 1: 135,406,817 S285T probably benign Het
Itga8 T C 2: 12,200,141 H495R probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Krtap8-1 A T 16: 89,487,901 Y3N possibly damaging Het
Krtap8-1 G T 16: 89,487,902 Y2* probably null Het
Lama1 T A 17: 67,810,114 L2468Q probably damaging Het
Lmo7 T C 14: 101,886,945 L280S probably damaging Het
Matk G A 10: 81,261,543 probably null Het
Mcmdc2 A G 1: 9,930,801 T434A possibly damaging Het
Mst1r T A 9: 107,917,870 L1283Q probably damaging Het
Ncln A G 10: 81,492,922 V174A probably benign Het
Nipa2 G A 7: 55,932,966 H344Y probably benign Het
Nlrp4g A G 9: 124,349,306 noncoding transcript Het
Olfr657 G T 7: 104,636,627 E318* probably null Het
Olfr768 T C 10: 129,093,892 I27M probably benign Het
Pik3r5 T C 11: 68,492,917 S521P probably damaging Het
Pkhd1l1 C T 15: 44,533,019 T1979M probably benign Het
Plekhn1 T G 4: 156,222,701 D464A probably damaging Het
Ppp4r1 T A 17: 65,833,050 Y648N probably damaging Het
Prkaa2 C T 4: 105,039,721 probably null Het
Prkdc T A 16: 15,684,204 H828Q probably benign Het
Prss40 A T 1: 34,559,903 Y69* probably null Het
Prx C T 7: 27,507,859 probably benign Het
Psmd11 T A 11: 80,428,704 S7T possibly damaging Het
Psmd14 A T 2: 61,800,007 H287L probably benign Het
Rcor1 T C 12: 111,109,792 Y297H probably damaging Het
Rnf40 T G 7: 127,591,576 V272G probably damaging Het
Serpina3f G T 12: 104,217,367 E163* probably null Het
Setd4 G A 16: 93,590,983 T205I probably damaging Het
Shroom1 A T 11: 53,466,447 T646S probably benign Het
Smg8 G C 11: 87,085,728 S342R probably benign Het
Trhde T C 10: 114,401,516 Y986C probably damaging Het
Tulp2 A T 7: 45,518,628 T155S possibly damaging Het
Vmn1r212 A T 13: 22,883,950 L71* probably null Het
Wnk2 A T 13: 49,039,168 C2032* probably null Het
Zfp429 A G 13: 67,390,627 Y233H probably benign Het
Zfp809 C A 9: 22,243,040 T351K probably benign Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.00
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 splice site probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
R7937:Nbn UTSW 4 15958080 missense probably damaging 0.99
R8110:Nbn UTSW 4 15981588 missense probably benign 0.02
R8317:Nbn UTSW 4 15970893 missense probably damaging 0.96
R8327:Nbn UTSW 4 15981470 missense probably benign 0.00
R8725:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8727:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8747:Nbn UTSW 4 15981555 missense probably damaging 0.96
R8909:Nbn UTSW 4 15970833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGCTCAGAACCCTCAC -3'
(R):5'- TACAGATATTCCACTGCCTAGCATC -3'

Sequencing Primer
(F):5'- AGAACCCTCACTGCAGCTGG -3'
(R):5'- TGCCTAGCATCGCACATC -3'
Posted On2014-10-30