Incidental Mutation 'R2364:Ubfd1'
ID247274
Institutional Source Beutler Lab
Gene Symbol Ubfd1
Ensembl Gene ENSMUSG00000030870
Gene Nameubiquitin family domain containing 1
SynonymsD7Wsu128e, D7Wsu105e
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location122067175-122082194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122068944 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 232 (D232E)
Ref Sequence ENSEMBL: ENSMUSP00000033158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033158] [ENSMUST00000033159]
PDB Structure
Solution structure of the ubiquitin domain from mouse D7Wsu128e protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033158
AA Change: D232E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033158
Gene: ENSMUSG00000030870
AA Change: D232E

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
UBQ 145 214 8.34e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033159
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Predicted Effect unknown
Transcript: ENSMUST00000153640
AA Change: D15E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Ubfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubfd1 APN 7 122078472 missense probably benign 0.04
IGL01677:Ubfd1 APN 7 122071699 splice site probably benign
R0883:Ubfd1 UTSW 7 122067491 unclassified probably benign
R3879:Ubfd1 UTSW 7 122068776 unclassified probably benign
R3880:Ubfd1 UTSW 7 122068776 unclassified probably benign
R3972:Ubfd1 UTSW 7 122067433 missense probably benign
R4241:Ubfd1 UTSW 7 122071754 missense possibly damaging 0.56
R5120:Ubfd1 UTSW 7 122071750 missense probably damaging 1.00
R5276:Ubfd1 UTSW 7 122068868 missense probably damaging 1.00
R6793:Ubfd1 UTSW 7 122067880 missense probably benign
R7493:Ubfd1 UTSW 7 122067412 missense probably benign 0.10
R7619:Ubfd1 UTSW 7 122067383 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGGTCCACGCATTTCCTG -3'
(R):5'- TCAGGTAGCTGTCAACTCCACTC -3'

Sequencing Primer
(F):5'- ATTCCTTTCCACTTTTTGTCAAGG -3'
(R):5'- ACTCTGCTGCACCCAACTG -3'
Posted On2014-10-30