Mutagenetix > Incidental Mutations

Incidental Mutation 'R2364:Pros1'

247285

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

040345-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2364 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 62913848 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 339 (L339R)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: L339R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: L339R

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	G	3: 138,165,823	S268P	probably benign	Het
Adam6a	A	G	12: 113,544,630	K208E	probably benign	Het
Anks6	A	G	4: 47,027,248	S725P	possibly damaging	Het
Asb3	A	G	11: 31,101,192	I549V	probably benign	Het
Blvrb	A	G	7: 27,448,133	I6V	possibly damaging	Het
Cabs1	A	T	5: 87,980,233	T248S	probably benign	Het
Cdk5rap2	A	G	4: 70,360,809		probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Fpr1	A	T	17: 17,877,610	L39*	probably null	Het
Gstm5	A	G	3: 107,896,371	E40G	probably benign	Het
Hnrnpr	A	G	4: 136,327,329	M97V	possibly damaging	Het
Hs6st1	T	C	1: 36,068,719	V21A	probably benign	Het
Hsp90aa1	A	T	12: 110,692,753	F537I	probably damaging	Het
Insr	T	C	8: 3,174,820	D216G	probably benign	Het
Kif2a	A	T	13: 106,976,836	N428K	probably damaging	Het
Mapk10	G	T	5: 103,038,641	N38K	possibly damaging	Het
Myh8	A	G	11: 67,294,518	E865G	probably benign	Het
Olfr1328	C	T	4: 118,934,033	E272K	probably benign	Het
Olfr1457	A	G	19: 13,094,754	V298A	probably damaging	Het
Olfr357	T	C	2: 36,997,565	Y252H	probably damaging	Het
Olfr731	A	T	14: 50,238,155	H243Q	probably damaging	Het
Os9	T	A	10: 127,119,138	K180N	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,938	I506F	probably damaging	Het
Srp72	A	G	5: 76,984,362	I266V	probably benign	Het
Tmem245	A	G	4: 56,899,391	V632A	probably damaging	Het
Tpcn1	G	T	5: 120,553,494	C298*	probably null	Het
Ubfd1	T	A	7: 122,068,944	D232E	probably benign	Het
Vamp1	A	T	6: 125,240,343	I117L	probably benign	Het
Wwtr1	T	C	3: 57,462,603	T364A	possibly damaging	Het
Zfp143	C	A	7: 110,083,242	T339K	probably damaging	Het
Zfp317	A	G	9: 19,647,735	D415G	probably benign	Het
Zfp628	A	G	7: 4,920,687	H636R	probably damaging	Het
Zfp651	C	T	9: 121,767,594	P672L	probably damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGAACCGGAAACAACCTGTG -3'
(R):5'- TGCTCCCACTTGACAATCAG -3'

Sequencing Primer
(F):5'- CAACCTGTGAACAATTTAATGCTGC -3'
(R):5'- GTGCATCCAAATAAGGAAATTGATTC -3'

Posted On

2014-10-30