Incidental Mutation 'R2364:Pros1'
ID 247285
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 040345-MU
Accession Numbers

Genbank: NM_011173; MGI: 1095733  
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2364 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 62913848 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 339 (L339R)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: L339R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: L339R

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62907739 missense probably damaging 1.00
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9131:Pros1 UTSW 16 62928034 missense probably damaging 0.96
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGAACCGGAAACAACCTGTG -3'
(R):5'- TGCTCCCACTTGACAATCAG -3'

Sequencing Primer
(F):5'- CAACCTGTGAACAATTTAATGCTGC -3'
(R):5'- GTGCATCCAAATAAGGAAATTGATTC -3'
Posted On 2014-10-30