Mutagenetix > Incidental Mutations

Incidental Mutation 'R2364:Srp72'

247266

Institutional Source

Beutler Lab

Gene Symbol

Srp72

Ensembl Gene

ENSMUSG00000036323

Gene Name

signal recognition particle 72

Synonyms

72kDa, 5730576P14Rik

MMRRC Submission

040345-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R2364 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76974683-76999937 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76984362 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 266 (I266V)

Ref Sequence

ENSEMBL: ENSMUSP00000098648 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]

Predicted Effect

probably benign
Transcript: ENSMUST00000101087
AA Change: I266V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: I266V

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
Pfam:TPR_9	19	70	2.7e-2	PFAM
Pfam:SRP_TPR_like	30	157	5.5e-25	PFAM
Pfam:TPR_8	176	208	2.3e-3	PFAM
Pfam:TPR_1	226	259	2.4e-4	PFAM
Pfam:TPR_2	226	259	4.9e-5	PFAM
Pfam:TPR_8	226	259	1.1e-2	PFAM
Pfam:TPR_9	412	490	1.3e-3	PFAM
Pfam:SRP72	531	588	6.2e-26	PFAM
low complexity region	630	639	N/A	INTRINSIC
low complexity region	647	668	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120550

SMART Domains

Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
Pfam:TPR_9	19	72	2.5e-2	PFAM
Blast:TPR	109	142	2e-11	BLAST
Blast:TPR	176	209	5e-10	BLAST
Pfam:TPR_6	280	310	2.5e-3	PFAM
Pfam:TPR_9	351	429	1.4e-3	PFAM
Pfam:SRP72	465	527	5.8e-24	PFAM
low complexity region	569	578	N/A	INTRINSIC
low complexity region	586	607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150661

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	G	3: 138,165,823	S268P	probably benign	Het
Adam6a	A	G	12: 113,544,630	K208E	probably benign	Het
Anks6	A	G	4: 47,027,248	S725P	possibly damaging	Het
Asb3	A	G	11: 31,101,192	I549V	probably benign	Het
Blvrb	A	G	7: 27,448,133	I6V	possibly damaging	Het
Cabs1	A	T	5: 87,980,233	T248S	probably benign	Het
Cdk5rap2	A	G	4: 70,360,809		probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Fpr1	A	T	17: 17,877,610	L39*	probably null	Het
Gstm5	A	G	3: 107,896,371	E40G	probably benign	Het
Hnrnpr	A	G	4: 136,327,329	M97V	possibly damaging	Het
Hs6st1	T	C	1: 36,068,719	V21A	probably benign	Het
Hsp90aa1	A	T	12: 110,692,753	F537I	probably damaging	Het
Insr	T	C	8: 3,174,820	D216G	probably benign	Het
Kif2a	A	T	13: 106,976,836	N428K	probably damaging	Het
Mapk10	G	T	5: 103,038,641	N38K	possibly damaging	Het
Myh8	A	G	11: 67,294,518	E865G	probably benign	Het
Olfr1328	C	T	4: 118,934,033	E272K	probably benign	Het
Olfr1457	A	G	19: 13,094,754	V298A	probably damaging	Het
Olfr357	T	C	2: 36,997,565	Y252H	probably damaging	Het
Olfr731	A	T	14: 50,238,155	H243Q	probably damaging	Het
Os9	T	A	10: 127,119,138	K180N	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,938	I506F	probably damaging	Het
Pros1	T	G	16: 62,913,848	L339R	probably damaging	Het
Tmem245	A	G	4: 56,899,391	V632A	probably damaging	Het
Tpcn1	G	T	5: 120,553,494	C298*	probably null	Het
Ubfd1	T	A	7: 122,068,944	D232E	probably benign	Het
Vamp1	A	T	6: 125,240,343	I117L	probably benign	Het
Wwtr1	T	C	3: 57,462,603	T364A	possibly damaging	Het
Zfp143	C	A	7: 110,083,242	T339K	probably damaging	Het
Zfp317	A	G	9: 19,647,735	D415G	probably benign	Het
Zfp628	A	G	7: 4,920,687	H636R	probably damaging	Het
Zfp651	C	T	9: 121,767,594	P672L	probably damaging	Het

Other mutations in Srp72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Srp72	APN	5	76984176	missense	probably damaging	1.00
IGL00915:Srp72	APN	5	76978613	nonsense	probably null
IGL02731:Srp72	APN	5	76994215	missense	probably damaging	0.98
PIT4468001:Srp72	UTSW	5	76994206	missense	probably benign
R0009:Srp72	UTSW	5	76987885	missense	probably damaging	0.98
R0318:Srp72	UTSW	5	76984200	missense	probably benign	0.27
R1645:Srp72	UTSW	5	76998278	missense	probably benign	0.05
R1678:Srp72	UTSW	5	76980307	missense	probably damaging	1.00
R1682:Srp72	UTSW	5	76987870	missense	possibly damaging	0.95
R2037:Srp72	UTSW	5	76976491	missense	probably damaging	1.00
R2876:Srp72	UTSW	5	76995920	splice site	probably benign
R4072:Srp72	UTSW	5	76998251	missense	probably benign	0.24
R4073:Srp72	UTSW	5	76998251	missense	probably benign	0.24
R4074:Srp72	UTSW	5	76998251	missense	probably benign	0.24
R4638:Srp72	UTSW	5	76990295	missense	probably benign	0.00
R4803:Srp72	UTSW	5	76984384	missense	probably damaging	0.97
R4864:Srp72	UTSW	5	76984162	missense	probably benign	0.35
R5188:Srp72	UTSW	5	76974751	missense	possibly damaging	0.54
R5217:Srp72	UTSW	5	76980528	missense	probably damaging	1.00
R5459:Srp72	UTSW	5	76984338	missense	probably benign	0.16
R5616:Srp72	UTSW	5	76987934	missense	probably damaging	1.00
R6460:Srp72	UTSW	5	76987991	missense	probably damaging	1.00
R6595:Srp72	UTSW	5	76984200	missense	probably benign	0.27
R6959:Srp72	UTSW	5	76994223	missense	possibly damaging	0.91
R6986:Srp72	UTSW	5	76994876	missense	probably benign	0.16
R7674:Srp72	UTSW	5	76974826	missense	probably damaging	0.98
Z1177:Srp72	UTSW	5	76998353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGCGTACATCATGCAGC -3'
(R):5'- AGCTTTACTAACGGCCAAGG -3'

Sequencing Primer
(F):5'- CTGCAGGGTCGCACAGAG -3'
(R):5'- GGCCTACAACTACAAAGATGATTTAC -3'

Posted On

2014-10-30