Incidental Mutation 'R2364:Olfr1457'
ID247289
Institutional Source Beutler Lab
Gene Symbol Olfr1457
Ensembl Gene ENSMUSG00000061637
Gene Nameolfactory receptor 1457
SynonymsGA_x6K02T2RE5P-3423041-3422097, MOR202-20
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13093379-13097891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13094754 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 298 (V298A)
Ref Sequence ENSEMBL: ENSMUSP00000150957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075170] [ENSMUST00000208913] [ENSMUST00000214561] [ENSMUST00000215229]
Predicted Effect probably damaging
Transcript: ENSMUST00000075170
AA Change: V298A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074665
Gene: ENSMUSG00000061637
AA Change: V298A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.6e-45 PFAM
Pfam:7tm_1 42 291 9.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably damaging
Transcript: ENSMUST00000214561
AA Change: V125A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215229
AA Change: V298A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Olfr1457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1457 APN 19 13095112 missense probably damaging 1.00
IGL01815:Olfr1457 APN 19 13095656 splice site probably null
IGL02033:Olfr1457 APN 19 13094857 missense possibly damaging 0.54
R0490:Olfr1457 UTSW 19 13094812 missense probably damaging 1.00
R1205:Olfr1457 UTSW 19 13095535 missense probably benign 0.01
R1299:Olfr1457 UTSW 19 13095130 missense possibly damaging 0.78
R1782:Olfr1457 UTSW 19 13094803 missense probably damaging 0.99
R1983:Olfr1457 UTSW 19 13095384 missense probably benign 0.01
R3815:Olfr1457 UTSW 19 13094913 missense probably damaging 0.98
R4092:Olfr1457 UTSW 19 13095426 missense probably damaging 0.97
R4430:Olfr1457 UTSW 19 13095088 missense probably benign 0.03
R7200:Olfr1457 UTSW 19 13095232 missense probably benign 0.04
R8079:Olfr1457 UTSW 19 13095284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCATAAGCTGCGGAATAC -3'
(R):5'- CACTCAAGTGCTGGATATGGGAAG -3'

Sequencing Primer
(F):5'- CTCATAAGCTGCGGAATACAATAG -3'
(R):5'- ATATGGGAAGGCTGCACCC -3'
Posted On2014-10-30