Incidental Mutation 'R2374:Ugt2a3'
ID248227
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms2010321J07Rik
MMRRC Submission 040353-MU
Accession Numbers

Genbank: NM_028094; MGI: 1919344

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2374 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87324972-87337195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87327191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 398 (D398G)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
Predicted Effect probably damaging
Transcript: ENSMUST00000031195
AA Change: D398G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: D398G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Meta Mutation Damage Score 0.8815 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.7%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,820,574 Y60H probably damaging Het
4932438A13Rik A G 3: 36,885,396 D133G probably benign Het
Adnp2 C T 18: 80,130,987 R69Q probably damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Clec4b1 T G 6: 123,050,638 L18R probably damaging Het
Cntrl G A 2: 35,153,276 V706I possibly damaging Het
Dhx30 A G 9: 110,091,564 L294P probably damaging Het
Dysf T C 6: 84,097,729 L504P probably damaging Het
Gm10754 A G 10: 97,682,151 probably benign Het
Grid1 G A 14: 35,321,807 probably benign Het
Hydin A G 8: 110,565,148 N3424S probably damaging Het
Itgb2 G A 10: 77,559,681 V539I probably benign Het
Itgb5 T A 16: 33,919,798 V426E probably damaging Het
Ly6e A G 15: 74,958,621 S107G probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Myo15 T G 11: 60,478,843 S810A possibly damaging Het
Neb A G 2: 52,263,657 W2419R probably damaging Het
Nkpd1 A T 7: 19,523,975 T560S possibly damaging Het
Olfr1272 A T 2: 90,282,451 S41R possibly damaging Het
Olfr135 T C 17: 38,209,067 M274T probably damaging Het
Rasa3 A G 8: 13,577,411 L697P probably damaging Het
Sptbn4 A G 7: 27,360,092 Y2443H probably damaging Het
Steap2 A G 5: 5,675,845 I393T probably damaging Het
Tbc1d12 T A 19: 38,837,170 L155Q possibly damaging Het
Tnni3k A T 3: 154,786,785 M816K probably benign Het
Vmn1r25 A T 6: 57,978,558 S249T probably benign Het
Vmn2r17 C A 5: 109,427,238 P137Q probably benign Het
Zbtb26 A G 2: 37,436,485 S180P probably benign Het
Zfy1 A T Y: 726,391 L458Q probably damaging Het
Zfy1 G C Y: 726,392 L458V possibly damaging Het
Zmpste24 T C 4: 121,074,537 E297G probably benign Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87325655 missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87336823 missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87336785 missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87327120 missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87325555 missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87336799 missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87337006 missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87327073 critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87336490 missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87336649 missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87327711 missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87327206 missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87327146 missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87325598 missense probably damaging 1.00
R2104:Ugt2a3 UTSW 5 87329682 splice site probably null
R2119:Ugt2a3 UTSW 5 87336571 missense probably damaging 0.98
R3082:Ugt2a3 UTSW 5 87325675 missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87337159 missense possibly damaging 0.74
R3894:Ugt2a3 UTSW 5 87329590 missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87336866 missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87327195 missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87331285 missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87331315 missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87327200 missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87336547 missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87336477 missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87336758 missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87325632 missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87337094 missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87325534 missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87336620 missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87327680 critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87327723 missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R8803:Ugt2a3 UTSW 5 87336530 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTCCAGAACGATGGCAAG -3'
(R):5'- TCTTCATCAGATATCATCACCCCAG -3'

Sequencing Primer
(F):5'- AAGGCTGCCAGTTTTCCACG -3'
(R):5'- CCCAGTTCCCAAACTTTAGAGG -3'
Posted On2014-11-11