Incidental Mutation 'R2423:Rft1'
ID 249452
Institutional Source Beutler Lab
Gene Symbol Rft1
Ensembl Gene ENSMUSG00000052395
Gene Name RFT1 homolog
Synonyms
MMRRC Submission 040385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 30654360-30691317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30666767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 216 (L216P)
Ref Sequence ENSEMBL: ENSMUSP00000064153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064230] [ENSMUST00000226817] [ENSMUST00000228686]
AlphaFold Q8C3B8
Predicted Effect possibly damaging
Transcript: ENSMUST00000064230
AA Change: L216P

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064153
Gene: ENSMUSG00000052395
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rft-1 9 530 2.2e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131097
AA Change: L216P

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120407
Gene: ENSMUSG00000052395
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rft-1 10 279 4.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143923
Predicted Effect probably benign
Transcript: ENSMUST00000155689
AA Change: L216P

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122990
Gene: ENSMUSG00000052395
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rft-1 10 378 1.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226817
AA Change: L216P

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228262
Predicted Effect probably benign
Transcript: ENSMUST00000228686
AA Change: L216P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the translocation of the Man(5)GlcNAc (2)-PP-Dol intermediate from the cytoplasmic to the luminal side of the endoplasmic reticulum membrane in the pathway for the N-glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type In.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Brf1 G A 12: 113,000,199 A53V probably benign Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Rft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rft1 APN 14 30676896 missense possibly damaging 0.71
IGL01642:Rft1 APN 14 30676868 missense probably damaging 1.00
IGL01654:Rft1 APN 14 30676880 missense probably damaging 0.99
IGL01970:Rft1 APN 14 30690535 missense probably benign
IGL02403:Rft1 APN 14 30660321 splice site probably benign
IGL02928:Rft1 APN 14 30663115 missense possibly damaging 0.78
IGL03186:Rft1 APN 14 30658349 missense possibly damaging 0.90
IGL03286:Rft1 APN 14 30661366 missense probably benign 0.00
R0276:Rft1 UTSW 14 30690583 missense probably benign 0.28
R0879:Rft1 UTSW 14 30682748 splice site probably benign
R1491:Rft1 UTSW 14 30666787 nonsense probably null
R3693:Rft1 UTSW 14 30690451 missense probably damaging 1.00
R4543:Rft1 UTSW 14 30661333 missense probably benign 0.24
R4611:Rft1 UTSW 14 30689790 missense probably damaging 0.98
R4878:Rft1 UTSW 14 30677804 missense probably benign 0.04
R5256:Rft1 UTSW 14 30661286 missense probably benign 0.03
R5382:Rft1 UTSW 14 30666782 missense probably benign 0.04
R5719:Rft1 UTSW 14 30663226 intron probably benign
R7200:Rft1 UTSW 14 30682857 critical splice donor site probably null
R7652:Rft1 UTSW 14 30677816 missense probably benign 0.15
R7657:Rft1 UTSW 14 30666767 missense probably damaging 1.00
R7851:Rft1 UTSW 14 30690583 missense probably benign 0.00
R8341:Rft1 UTSW 14 30689881 missense probably damaging 1.00
R8777:Rft1 UTSW 14 30660199 missense probably damaging 1.00
R8777-TAIL:Rft1 UTSW 14 30660199 missense probably damaging 1.00
R9288:Rft1 UTSW 14 30661458 nonsense probably null
R9301:Rft1 UTSW 14 30676855 missense probably damaging 1.00
R9427:Rft1 UTSW 14 30689824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTAGAGCCTATGCACAGGAG -3'
(R):5'- ACCTAGTATGTGGCAAGCACTC -3'

Sequencing Primer
(F):5'- AGGACACTTTTATGCCTTGATTGACC -3'
(R):5'- TGTGGCAAGCACTCAATAAATAC -3'
Posted On 2014-11-12