Incidental Mutation 'R2423:Brf1'
ID 249449
Institutional Source Beutler Lab
Gene Symbol Brf1
Ensembl Gene ENSMUSG00000011158
Gene Name BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms GTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C
MMRRC Submission 040385-MU
Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R2423 (G1)
Quality Score 98
Status Not validated
Chromosome 12
Chromosomal Location 112960085-113000704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113000199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 53 (A53V)
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011302]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000011302
AA Change: A53V

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: A53V

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180971
SMART Domains Protein: ENSMUSP00000138066
Gene: ENSMUSG00000097100

DomainStartEndE-ValueType
low complexity region 40 52 N/A INTRINSIC
low complexity region 77 85 N/A INTRINSIC
low complexity region 101 115 N/A INTRINSIC
low complexity region 120 182 N/A INTRINSIC
low complexity region 189 200 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223037
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,379,207 S284P possibly damaging Het
Ap5z1 T C 5: 142,476,777 V614A probably benign Het
Arhgap9 A T 10: 127,327,124 probably null Het
Cyp1a2 C T 9: 57,679,949 R353Q probably damaging Het
Deup1 G T 9: 15,592,458 S269* probably null Het
F11r T A 1: 171,461,623 Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Mapkbp1 A T 2: 120,024,590 E1430V probably benign Het
Mga A G 2: 119,964,793 K2986R probably damaging Het
Myo9b G T 8: 71,327,940 V494L probably damaging Het
Nbea G A 3: 56,085,306 T293I probably damaging Het
Neto2 C T 8: 85,669,767 R83Q probably damaging Het
Ocm A T 5: 144,024,570 probably null Het
Olfr619 C T 7: 103,604,034 R127C probably benign Het
Pcdha11 T C 18: 37,007,424 I702T possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rbbp8nl A T 2: 180,280,971 S210T probably damaging Het
Rbl2 A T 8: 91,087,146 I340F probably benign Het
Rft1 T C 14: 30,666,767 L216P possibly damaging Het
Slc26a10 T A 10: 127,179,737 probably null Het
Slc34a1 G A 13: 55,409,052 A235T possibly damaging Het
Spag17 A G 3: 100,103,456 T2089A probably benign Het
Srek1 G C 13: 103,753,028 S260* probably null Het
Sspo T C 6: 48,454,055 V624A probably benign Het
Tapt1 T C 5: 44,192,453 I251V probably benign Het
Tmem248 T C 5: 130,229,562 I32T probably damaging Het
Tnk1 T G 11: 69,855,761 T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Trp53tg5 T A 2: 164,471,330 R142* probably null Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vldlr C T 19: 27,236,288 T125I possibly damaging Het
Vps8 A G 16: 21,559,337 T1033A probably benign Het
Wiz A C 17: 32,361,885 H197Q probably damaging Het
Other mutations in Brf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Brf1 APN 12 112963600 splice site probably benign
IGL01609:Brf1 APN 12 112963591 missense probably damaging 1.00
IGL01610:Brf1 APN 12 112988083 missense probably benign
IGL01622:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01623:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01791:Brf1 APN 12 112962475 missense probably benign 0.00
IGL02037:Brf1 APN 12 112993062 critical splice donor site probably null
IGL02227:Brf1 APN 12 112961774 missense probably damaging 1.00
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0138:Brf1 UTSW 12 112961139 missense probably damaging 0.99
R1345:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1370:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1927:Brf1 UTSW 12 113000344 missense possibly damaging 0.95
R3608:Brf1 UTSW 12 112961274 missense probably benign 0.00
R3703:Brf1 UTSW 12 112969371 splice site probably null
R4033:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R4817:Brf1 UTSW 12 112972301 missense probably damaging 0.99
R4897:Brf1 UTSW 12 112965887 missense probably benign 0.05
R4985:Brf1 UTSW 12 112969370 splice site probably null
R5092:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R7138:Brf1 UTSW 12 112970215 missense probably damaging 1.00
R7187:Brf1 UTSW 12 112960325 missense unknown
R7726:Brf1 UTSW 12 112964245 missense probably benign
R7970:Brf1 UTSW 12 112964200 missense probably damaging 1.00
R8719:Brf1 UTSW 12 112979684 critical splice donor site probably benign
R8897:Brf1 UTSW 12 112987969 missense probably damaging 1.00
R8967:Brf1 UTSW 12 112973619 missense probably damaging 1.00
R9109:Brf1 UTSW 12 112963391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACATCGGCGTACGGGAC -3'
(R):5'- GAGTTCCTTTATCGGTCCCG -3'

Sequencing Primer
(F):5'- ACCTGGCTGCAGATTCCC -3'
(R):5'- GAATCTGCCGCGACGAATC -3'
Posted On 2014-11-12