Mutagenetix > Incidental Mutations

Incidental Mutation 'R2423:Brf1'

249449

Institutional Source

Beutler Lab

Gene Symbol

Brf1

Ensembl Gene

ENSMUSG00000011158

Gene Name

BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit

Synonyms

GTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C

MMRRC Submission

040385-MU

Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R2423 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

112960085-113000704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 113000199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 53 (A53V)

Ref Sequence

ENSEMBL: ENSMUSP00000011302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000011302
AA Change: A53V

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: A53V

Domain	Start	End	E-Value	Type
Pfam:TF_Zn_Ribbon	4	46	4.3e-17	PFAM
CYCLIN	91	172	1.93e-12	SMART
CYCLIN	185	269	1.22e-9	SMART
coiled coil region	298	334	N/A	INTRINSIC
low complexity region	362	374	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
Pfam:BRF1	452	545	3.3e-29	PFAM
low complexity region	638	650	N/A	INTRINSIC
low complexity region	662	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180971

SMART Domains

Protein: ENSMUSP00000138066
Gene: ENSMUSG00000097100

Domain	Start	End	E-Value	Type
low complexity region	40	52	N/A	INTRINSIC
low complexity region	77	85	N/A	INTRINSIC
low complexity region	101	115	N/A	INTRINSIC
low complexity region	120	182	N/A	INTRINSIC
low complexity region	189	200	N/A	INTRINSIC
low complexity region	244	261	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223037

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer2	T	C	14: 60,379,207	S284P	possibly damaging	Het
Ap5z1	T	C	5: 142,476,777	V614A	probably benign	Het
Arhgap9	A	T	10: 127,327,124		probably null	Het
Cyp1a2	C	T	9: 57,679,949	R353Q	probably damaging	Het
Deup1	G	T	9: 15,592,458	S269*	probably null	Het
F11r	T	A	1: 171,461,623	Y218N	possibly damaging	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Mapkbp1	A	T	2: 120,024,590	E1430V	probably benign	Het
Mga	A	G	2: 119,964,793	K2986R	probably damaging	Het
Myo9b	G	T	8: 71,327,940	V494L	probably damaging	Het
Nbea	G	A	3: 56,085,306	T293I	probably damaging	Het
Neto2	C	T	8: 85,669,767	R83Q	probably damaging	Het
Ocm	A	T	5: 144,024,570		probably null	Het
Olfr619	C	T	7: 103,604,034	R127C	probably benign	Het
Pcdha11	T	C	18: 37,007,424	I702T	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rbbp8nl	A	T	2: 180,280,971	S210T	probably damaging	Het
Rbl2	A	T	8: 91,087,146	I340F	probably benign	Het
Rft1	T	C	14: 30,666,767	L216P	possibly damaging	Het
Slc26a10	T	A	10: 127,179,737		probably null	Het
Slc34a1	G	A	13: 55,409,052	A235T	possibly damaging	Het
Spag17	A	G	3: 100,103,456	T2089A	probably benign	Het
Srek1	G	C	13: 103,753,028	S260*	probably null	Het
Sspo	T	C	6: 48,454,055	V624A	probably benign	Het
Tapt1	T	C	5: 44,192,453	I251V	probably benign	Het
Tmem248	T	C	5: 130,229,562	I32T	probably damaging	Het
Tnk1	T	G	11: 69,855,761	T209P	probably damaging	Het
Trip12	TATACATACATACATACATACATACATACATAC	TATACATACATACATACATACATACATACATACATAC	1: 84,814,790		probably null	Het
Trp53tg5	T	A	2: 164,471,330	R142*	probably null	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vldlr	C	T	19: 27,236,288	T125I	possibly damaging	Het
Vps8	A	G	16: 21,559,337	T1033A	probably benign	Het
Wiz	A	C	17: 32,361,885	H197Q	probably damaging	Het

Other mutations in Brf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00928:Brf1	APN	12	112963600	splice site	probably benign
IGL01609:Brf1	APN	12	112963591	missense	probably damaging	1.00
IGL01610:Brf1	APN	12	112988083	missense	probably benign
IGL01622:Brf1	APN	12	112961175	missense	probably benign	0.02
IGL01623:Brf1	APN	12	112961175	missense	probably benign	0.02
IGL01791:Brf1	APN	12	112962475	missense	probably benign	0.00
IGL02037:Brf1	APN	12	112993062	critical splice donor site	probably null
IGL02227:Brf1	APN	12	112961774	missense	probably damaging	1.00
R0106:Brf1	UTSW	12	112973463	unclassified	probably benign
R0106:Brf1	UTSW	12	112973463	unclassified	probably benign
R0138:Brf1	UTSW	12	112961139	missense	probably damaging	0.99
R1345:Brf1	UTSW	12	112961108	critical splice donor site	probably null
R1370:Brf1	UTSW	12	112961108	critical splice donor site	probably null
R1927:Brf1	UTSW	12	113000344	missense	possibly damaging	0.95
R3608:Brf1	UTSW	12	112961274	missense	probably benign	0.00
R3703:Brf1	UTSW	12	112969371	splice site	probably null
R4033:Brf1	UTSW	12	112979732	missense	probably damaging	1.00
R4817:Brf1	UTSW	12	112972301	missense	probably damaging	0.99
R4897:Brf1	UTSW	12	112965887	missense	probably benign	0.05
R4985:Brf1	UTSW	12	112969370	splice site	probably null
R5092:Brf1	UTSW	12	112979732	missense	probably damaging	1.00
R7138:Brf1	UTSW	12	112970215	missense	probably damaging	1.00
R7187:Brf1	UTSW	12	112960325	missense	unknown
R7726:Brf1	UTSW	12	112964245	missense	probably benign
R7970:Brf1	UTSW	12	112964200	missense	probably damaging	1.00
R8719:Brf1	UTSW	12	112979684	critical splice donor site	probably benign
R8897:Brf1	UTSW	12	112987969	missense	probably damaging	1.00
R8967:Brf1	UTSW	12	112973619	missense	probably damaging	1.00
R9109:Brf1	UTSW	12	112963391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTACATCGGCGTACGGGAC -3'
(R):5'- GAGTTCCTTTATCGGTCCCG -3'

Sequencing Primer
(F):5'- ACCTGGCTGCAGATTCCC -3'
(R):5'- GAATCTGCCGCGACGAATC -3'

Posted On

2014-11-12