Mutagenetix > Incidental Mutation

Incidental Mutation 'R2474:Secisbp2l'

253255

Institutional Source

Beutler Lab

Gene Symbol

Secisbp2l

Ensembl Gene

ENSMUSG00000035093

Gene Name

SECIS binding protein 2-like

Synonyms

3110001I20Rik

MMRRC Submission

040405-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.664) question?

Stock #

R2474 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125736986-125782870 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125740737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 933 (G933D)

Ref Sequence

ENSEMBL: ENSMUSP00000055772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053699]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

Domain	Start	End	E-Value	Type
low complexity region	441	459	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	700	802	7.6e-24	PFAM
low complexity region	821	831	N/A	INTRINSIC
low complexity region	970	978	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139944

SMART Domains

Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

Domain	Start	End	E-Value	Type
low complexity region	67	85	N/A	INTRINSIC
low complexity region	181	194	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	326	427	3.5e-24	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,542,724	T678A	probably benign	Het
Asb7	A	T	7: 66,679,153	N46K	probably damaging	Het
Atxn7l2	A	C	3: 108,203,977	S414R	probably damaging	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Cxcl13	C	T	5: 95,959,957	Q91*	probably null	Het
Dchs1	T	C	7: 105,755,074	N2754D	probably benign	Het
Dchs1	A	T	7: 105,772,838	V125E	probably damaging	Het
Enpep	G	C	3: 129,284,158	S603R	possibly damaging	Het
Greb1	T	C	12: 16,714,953	N393S	possibly damaging	Het
Hfm1	A	T	5: 106,872,416	V1048D	possibly damaging	Het
Ilvbl	T	C	10: 78,576,724	V93A	probably damaging	Het
Itpkb	A	G	1: 180,334,151	D614G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lgi3	G	A	14: 70,533,249		probably null	Het
Mpeg1	G	A	19: 12,462,249	C357Y	probably damaging	Het
Nedd1	A	G	10: 92,719,603	F7L	probably damaging	Het
Olfr1082	C	A	2: 86,594,613	V72F	probably benign	Het
Olfr943	A	G	9: 39,184,550	D121G	probably damaging	Het
Parp8	A	T	13: 116,893,041	C510S	possibly damaging	Het
Phb	T	C	11: 95,671,422	F42L	possibly damaging	Het
Pik3r1	A	T	13: 101,702,776	Y189*	probably null	Het
Rps5	T	A	7: 12,926,561		probably null	Het
Senp3	T	A	11: 69,674,097	N516Y	probably damaging	Het
Tfap2b	A	T	1: 19,214,375	H169L	possibly damaging	Het
Tmem260	A	G	14: 48,496,324	D226G	probably null	Het
Ttc6	G	T	12: 57,575,927	R37S	probably benign	Het
Vmn2r84	A	T	10: 130,386,523	D609E	possibly damaging	Het
Vmn2r99	A	T	17: 19,378,629	M192L	probably benign	Het
Zfp746	T	C	6: 48,064,769	D341G	probably damaging	Het
Zfp941	A	T	7: 140,811,471	H658Q	probably damaging	Het
Zw10	T	A	9: 49,066,805	I351N	probably damaging	Het

Other mutations in Secisbp2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Secisbp2l	APN	2	125743856	missense	probably damaging	0.99
IGL00644:Secisbp2l	APN	2	125743844	missense	probably damaging	1.00
IGL01093:Secisbp2l	APN	2	125740325	missense	probably benign
IGL01621:Secisbp2l	APN	2	125773211	missense	probably benign
IGL01955:Secisbp2l	APN	2	125743812	critical splice donor site	probably null
IGL02036:Secisbp2l	APN	2	125758207	missense	probably benign
IGL02045:Secisbp2l	APN	2	125775578	missense	possibly damaging	0.82
IGL02182:Secisbp2l	APN	2	125747577	missense	probably damaging	1.00
IGL02408:Secisbp2l	APN	2	125740869	nonsense	probably null
IGL02455:Secisbp2l	APN	2	125773478	missense	possibly damaging	0.89
IGL02953:Secisbp2l	APN	2	125760274	missense	probably benign	0.36
Rift	UTSW	2	125768193	missense	probably damaging	1.00
Seismic	UTSW	2	125745909	missense	probably damaging	1.00
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R1415:Secisbp2l	UTSW	2	125740365	missense	probably benign	0.00
R1626:Secisbp2l	UTSW	2	125775686	missense	probably damaging	0.99
R1926:Secisbp2l	UTSW	2	125740677	missense	probably damaging	0.99
R1940:Secisbp2l	UTSW	2	125740339	missense	probably damaging	1.00
R1970:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R2100:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2240:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2252:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2253:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2472:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2475:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2990:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2993:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3113:Secisbp2l	UTSW	2	125750286	missense	probably damaging	1.00
R3696:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3750:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3800:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3810:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3812:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3815:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3816:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3817:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3880:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4077:Secisbp2l	UTSW	2	125751865	splice site	probably benign
R4096:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4097:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4164:Secisbp2l	UTSW	2	125751883	intron	probably benign
R4332:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4418:Secisbp2l	UTSW	2	125752915	missense	probably benign	0.00
R4598:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4600:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4602:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4603:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4678:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4679:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4684:Secisbp2l	UTSW	2	125745942	missense	probably damaging	1.00
R4741:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4934:Secisbp2l	UTSW	2	125740489	missense	probably damaging	0.99
R5245:Secisbp2l	UTSW	2	125747591	missense	probably damaging	1.00
R5521:Secisbp2l	UTSW	2	125752977	missense	possibly damaging	0.94
R5547:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5630:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5631:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5632:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6378:Secisbp2l	UTSW	2	125768325	missense	possibly damaging	0.78
R6616:Secisbp2l	UTSW	2	125768226	missense	probably damaging	0.96
R6938:Secisbp2l	UTSW	2	125750352	missense	probably damaging	1.00
R7287:Secisbp2l	UTSW	2	125740369	missense	probably benign
R7373:Secisbp2l	UTSW	2	125757271	missense	probably damaging	0.99
R7403:Secisbp2l	UTSW	2	125760279	missense	possibly damaging	0.73
R7484:Secisbp2l	UTSW	2	125771532	nonsense	probably null
R7504:Secisbp2l	UTSW	2	125758171	missense	probably benign	0.30
R7762:Secisbp2l	UTSW	2	125768193	missense	probably damaging	1.00
R7769:Secisbp2l	UTSW	2	125771545	critical splice acceptor site	probably benign
R8018:Secisbp2l	UTSW	2	125745909	missense	probably damaging	1.00
R8487:Secisbp2l	UTSW	2	125775582	nonsense	probably null
R8784:Secisbp2l	UTSW	2	125760343	nonsense	probably null
R8810:Secisbp2l	UTSW	2	125775676	missense	possibly damaging	0.82
R8872:Secisbp2l	UTSW	2	125752972	missense	probably benign
R9111:Secisbp2l	UTSW	2	125760286	missense	probably benign
R9154:Secisbp2l	UTSW	2	125775703	missense	probably damaging	1.00
R9155:Secisbp2l	UTSW	2	125775703	missense	probably damaging	1.00
R9589:Secisbp2l	UTSW	2	125747505	missense	probably benign	0.03
R9589:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R9592:Secisbp2l	UTSW	2	125740641	missense	probably damaging	1.00
R9602:Secisbp2l	UTSW	2	125767436	missense	probably benign	0.19
R9620:Secisbp2l	UTSW	2	125747474	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- CTTGTAGAGACTAACTGGAGGAGC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- AGCATGGTGGAGACGTCC -3'

Posted On

2014-12-04