Mutagenetix > Incidental Mutation

Incidental Mutation 'R3276:Mut'

258242

Institutional Source

Beutler Lab

Gene Symbol

Mut

Ensembl Gene

ENSMUSG00000023921

Gene Name

methylmalonyl-Coenzyme A mutase

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3276 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

40934685-40961989 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 40958872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169611]

AlphaFold

P16332

Predicted Effect

probably null
Transcript: ENSMUST00000169611

SMART Domains

Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921

Domain	Start	End	E-Value	Type
Pfam:MM_CoA_mutase	60	572	3.7e-240	PFAM
Pfam:B12-binding	613	731	4.7e-17	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dmbt1	A	G	7: 131,088,071	T715A	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Golga3	T	C	5: 110,201,998		probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mthfd1l	G	C	10: 4,148,025	G954A	probably damaging	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Nsun6	A	G	2: 15,009,404		probably benign	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rad54l2	A	G	9: 106,753,943		probably null	Het
Ranbp1	T	C	16: 18,247,429		probably benign	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Mut

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01482:Mut	APN	17	40956271	missense	probably damaging	0.99
IGL01666:Mut	APN	17	40958811	missense	probably damaging	1.00
IGL02141:Mut	APN	17	40938817	missense	possibly damaging	0.68
IGL02257:Mut	APN	17	40938734	missense	possibly damaging	0.78
IGL02538:Mut	APN	17	40938619	missense	probably damaging	1.00
mix	UTSW	17	40941383	missense	possibly damaging	0.66
mongrel	UTSW	17	40938731	missense	possibly damaging	0.77
R0115:Mut	UTSW	17	40956227	missense	probably damaging	1.00
R0381:Mut	UTSW	17	40937258	missense	probably benign	0.04
R0603:Mut	UTSW	17	40947166	missense	probably damaging	0.99
R0928:Mut	UTSW	17	40937283	missense	probably benign	0.24
R1292:Mut	UTSW	17	40941407	missense	probably damaging	1.00
R1452:Mut	UTSW	17	40937468	splice site	probably benign
R1460:Mut	UTSW	17	40937375	missense	probably damaging	1.00
R2044:Mut	UTSW	17	40941451	missense	probably benign	0.00
R2256:Mut	UTSW	17	40956319	missense	probably benign	0.02
R2448:Mut	UTSW	17	40958841	missense	probably damaging	0.96
R3113:Mut	UTSW	17	40958356	missense	probably damaging	1.00
R3176:Mut	UTSW	17	40958872	splice site	probably null
R3894:Mut	UTSW	17	40955139	missense	probably damaging	0.97
R4624:Mut	UTSW	17	40947055	missense	probably damaging	1.00
R4801:Mut	UTSW	17	40937351	missense	probably benign	0.08
R4802:Mut	UTSW	17	40937351	missense	probably benign	0.08
R5031:Mut	UTSW	17	40938827	missense	possibly damaging	0.96
R5394:Mut	UTSW	17	40947184	missense	probably benign	0.02
R5651:Mut	UTSW	17	40947111	missense	probably damaging	1.00
R6225:Mut	UTSW	17	40938731	missense	possibly damaging	0.77
R6274:Mut	UTSW	17	40956245	missense	probably benign	0.00
R7002:Mut	UTSW	17	40941383	missense	possibly damaging	0.66
R7141:Mut	UTSW	17	40952839	missense	possibly damaging	0.68
R7203:Mut	UTSW	17	40938673	missense	probably benign	0.06
R7868:Mut	UTSW	17	40947043	missense	probably damaging	1.00
R8050:Mut	UTSW	17	40943893	missense	probably benign	0.06
R8228:Mut	UTSW	17	40937328	missense	possibly damaging	0.92
R8904:Mut	UTSW	17	40937393	missense	probably damaging	1.00
R8977:Mut	UTSW	17	40938590	missense	probably benign
R9182:Mut	UTSW	17	40941419	missense	probably damaging	1.00
RF021:Mut	UTSW	17	40951758	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGACTTGCTTCACCCTTAC -3'
(R):5'- TACTGAGCCGCCTAAGAACTC -3'

Sequencing Primer
(F):5'- TCACCCTTACCTTGTAATAACCAG -3'
(R):5'- GAACTCCAGTCTTAACCAGTGTGG -3'

Posted On

2015-01-23