Incidental Mutation 'R3716:Mroh7'
ID259903
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Namemaestro heat-like repeat family member 7
SynonymsHeatr8, LOC381538, Gm1027
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106680417-106730925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106704210 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 612 (E612G)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770] [ENSMUST00000145044]
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: E612G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: E612G

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142954
Predicted Effect probably benign
Transcript: ENSMUST00000145044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106703161 missense probably benign 0.00
IGL01729:Mroh7 APN 4 106704205 missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106680874 missense probably benign 0.00
IGL02003:Mroh7 APN 4 106702529 missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106702510 missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106707782 missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106720591 missense probably benign 0.04
IGL02896:Mroh7 APN 4 106699816 missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106692398 missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106714091 nonsense probably null
holy UTSW 4 106709955 splice site probably null
moley UTSW 4 106694312 splice site probably null
P0016:Mroh7 UTSW 4 106707857 critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106721426 missense probably benign 0.07
R0094:Mroh7 UTSW 4 106703184 missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106691664 missense probably benign 0.01
R0828:Mroh7 UTSW 4 106699876 missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106680793 missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106707594 unclassified probably null
R1301:Mroh7 UTSW 4 106720495 missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106695141 splice site probably benign
R1491:Mroh7 UTSW 4 106703058 missense probably benign 0.11
R1540:Mroh7 UTSW 4 106703076 missense probably benign 0.11
R1560:Mroh7 UTSW 4 106711254 missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106720668 missense probably benign 0.19
R1804:Mroh7 UTSW 4 106694392 missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106700181 missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106720927 missense probably benign 0.01
R2866:Mroh7 UTSW 4 106691090 missense probably damaging 1.00
R3718:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R4530:Mroh7 UTSW 4 106720437 missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106691513 critical splice donor site probably null
R4706:Mroh7 UTSW 4 106691624 missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106709955 splice site probably null
R4965:Mroh7 UTSW 4 106690987 missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106680873 missense probably benign
R4971:Mroh7 UTSW 4 106691552 missense probably benign 0.04
R5083:Mroh7 UTSW 4 106690318 missense probably benign 0.03
R5207:Mroh7 UTSW 4 106721386 missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106691643 missense probably benign 0.10
R5392:Mroh7 UTSW 4 106711251 critical splice donor site probably null
R5630:Mroh7 UTSW 4 106720567 missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106702618 missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106708560 missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106681885 missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106694312 splice site probably null
R5979:Mroh7 UTSW 4 106720926 missense probably benign 0.00
R6479:Mroh7 UTSW 4 106703188 missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106721263 missense probably benign 0.00
R6657:Mroh7 UTSW 4 106702500 nonsense probably null
R6732:Mroh7 UTSW 4 106680713 frame shift probably null
R6817:Mroh7 UTSW 4 106714115 missense probably benign 0.00
R6980:Mroh7 UTSW 4 106700237 missense probably benign 0.05
R7062:Mroh7 UTSW 4 106683980 missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106711320 missense probably benign 0.07
R7134:Mroh7 UTSW 4 106720594 missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106691639 missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106683918 missense probably benign
R7516:Mroh7 UTSW 4 106691119 missense probably benign 0.00
R7525:Mroh7 UTSW 4 106709702 missense probably benign 0.22
R7540:Mroh7 UTSW 4 106720398 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GACACCCAGGATAGCTATGCAG -3'
(R):5'- TGTGAGTCCATGAATGAAAGTCC -3'

Sequencing Primer
(F):5'- TATGCAGCTGGAGAAGGCGTC -3'
(R):5'- TACCTAGAGCTTCAGAAACCAGGG -3'
Posted On2015-01-23