Incidental Mutation 'R3718:Mroh7'
ID258787
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Namemaestro heat-like repeat family member 7
SynonymsHeatr8, LOC381538, Gm1027
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106680417-106730925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106704210 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 612 (E612G)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770] [ENSMUST00000145044]
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: E612G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: E612G

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142954
Predicted Effect probably benign
Transcript: ENSMUST00000145044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106703161 missense probably benign 0.00
IGL01729:Mroh7 APN 4 106704205 missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106680874 missense probably benign 0.00
IGL02003:Mroh7 APN 4 106702529 missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106702510 missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106707782 missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106720591 missense probably benign 0.04
IGL02896:Mroh7 APN 4 106699816 missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106692398 missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106714091 nonsense probably null
holy UTSW 4 106709955 splice site probably null
moley UTSW 4 106694312 splice site probably null
P0016:Mroh7 UTSW 4 106707857 critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106721426 missense probably benign 0.07
R0094:Mroh7 UTSW 4 106703184 missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106691664 missense probably benign 0.01
R0828:Mroh7 UTSW 4 106699876 missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106680793 missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106707594 unclassified probably null
R1301:Mroh7 UTSW 4 106720495 missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106695141 splice site probably benign
R1491:Mroh7 UTSW 4 106703058 missense probably benign 0.11
R1540:Mroh7 UTSW 4 106703076 missense probably benign 0.11
R1560:Mroh7 UTSW 4 106711254 missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106720668 missense probably benign 0.19
R1804:Mroh7 UTSW 4 106694392 missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106700181 missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106720927 missense probably benign 0.01
R2866:Mroh7 UTSW 4 106691090 missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R4530:Mroh7 UTSW 4 106720437 missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106691513 critical splice donor site probably null
R4706:Mroh7 UTSW 4 106691624 missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106709955 splice site probably null
R4965:Mroh7 UTSW 4 106690987 missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106680873 missense probably benign
R4971:Mroh7 UTSW 4 106691552 missense probably benign 0.04
R5083:Mroh7 UTSW 4 106690318 missense probably benign 0.03
R5207:Mroh7 UTSW 4 106721386 missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106691643 missense probably benign 0.10
R5392:Mroh7 UTSW 4 106711251 critical splice donor site probably null
R5630:Mroh7 UTSW 4 106720567 missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106702618 missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106708560 missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106681885 missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106694312 splice site probably null
R5979:Mroh7 UTSW 4 106720926 missense probably benign 0.00
R6479:Mroh7 UTSW 4 106703188 missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106721263 missense probably benign 0.00
R6657:Mroh7 UTSW 4 106702500 nonsense probably null
R6732:Mroh7 UTSW 4 106680713 frame shift probably null
R6817:Mroh7 UTSW 4 106714115 missense probably benign 0.00
R6980:Mroh7 UTSW 4 106700237 missense probably benign 0.05
R7062:Mroh7 UTSW 4 106683980 missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106711320 missense probably benign 0.07
R7134:Mroh7 UTSW 4 106720594 missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106691639 missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106683918 missense probably benign
R7516:Mroh7 UTSW 4 106691119 missense probably benign 0.00
R7525:Mroh7 UTSW 4 106709702 missense probably benign 0.22
R7540:Mroh7 UTSW 4 106720398 missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106721090 missense probably benign
R7932:Mroh7 UTSW 4 106721090 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACCCAGGATAGCTATGCAG -3'
(R):5'- GTCCATGAATGAAAGTCCAAAAGC -3'

Sequencing Primer
(F):5'- TATGCAGCTGGAGAAGGCGTC -3'
(R):5'- TACCTAGAGCTTCAGAAACCAGGG -3'
Posted On2015-01-23