Mutagenetix > Incidental Mutations

Incidental Mutation 'R3718:Mroh7'

258787

Institutional Source

Beutler Lab

Gene Symbol

Mroh7

Ensembl Gene

ENSMUSG00000047502

Gene Name

maestro heat-like repeat family member 7

Synonyms

Heatr8, LOC381538, Gm1027

MMRRC Submission

040710-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106680417-106730925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106704210 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 612 (E612G)

Ref Sequence

ENSEMBL: ENSMUSP00000102382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106770] [ENSMUST00000145044]

Predicted Effect

probably benign
Transcript: ENSMUST00000106770
AA Change: E612G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: E612G

Domain	Start	End	E-Value	Type
low complexity region	39	61	N/A	INTRINSIC
low complexity region	318	332	N/A	INTRINSIC
low complexity region	563	573	N/A	INTRINSIC
SCOP:d1b3ua_	634	1218	6e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142954

Predicted Effect

probably benign
Transcript: ENSMUST00000145044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145374

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

97% (36/37)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abra	T	C	15: 41,866,293	D237G	probably benign	Het
Alas2	T	C	X: 150,560,730		probably benign	Het
Ano6	A	G	15: 95,913,379	D120G	probably damaging	Het
Aspm	T	C	1: 139,480,889	Y2505H	probably benign	Het
Aspm	G	A	1: 139,490,427	V2965I	probably benign	Het
Ccna2	A	T	3: 36,566,238	V285E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnajc10	A	G	2: 80,324,745		probably benign	Het
Dpp3	A	G	19: 4,923,065		probably null	Het
Gng11	G	A	6: 4,008,078	R47H	probably benign	Het
Hivep1	C	T	13: 42,158,495	H1404Y	probably damaging	Het
Il18r1	A	G	1: 40,495,788	E381G	probably benign	Het
Il9	G	A	13: 56,479,451	T116I	probably damaging	Het
Kcnh1	A	G	1: 192,238,799	T129A	probably damaging	Het
Nav1	A	T	1: 135,450,630	I1653K	probably damaging	Het
Neb	T	C	2: 52,277,470	E1948G	probably damaging	Het
Ntsr1	T	C	2: 180,542,706	F401L	probably benign	Het
Nup210	A	T	6: 91,020,180	D1626E	probably benign	Het
Olfr1277	A	G	2: 111,270,226	V47A	probably benign	Het
Olfr1495	A	G	19: 13,769,064	R241G	probably damaging	Het
Olfr943	A	G	9: 39,185,065	R293G	probably damaging	Het
Pign	A	G	1: 105,649,281		probably null	Het
Rad54l2	A	G	9: 106,693,527	V1198A	probably benign	Het
Sh3tc2	T	C	18: 61,990,343	V725A	probably benign	Het
Skint10	A	T	4: 112,746,739	W84R	probably damaging	Het
Slc40a1	G	T	1: 45,910,991	H434N	probably benign	Het
Trdv2-1	T	C	14: 53,946,538	Y76H	probably benign	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Ttn	G	A	2: 76,745,214	P25112S	probably damaging	Het
Ubac1	C	T	2: 26,014,941	R95H	probably damaging	Het
Vps13d	A	G	4: 145,075,726	I405T	probably damaging	Het
Zc3hav1l	G	T	6: 38,295,125	S236R	probably damaging	Het

Other mutations in Mroh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Mroh7	APN	4	106703161	missense	probably benign	0.00
IGL01729:Mroh7	APN	4	106704205	missense	possibly damaging	0.66
IGL01834:Mroh7	APN	4	106680874	missense	probably benign	0.00
IGL02003:Mroh7	APN	4	106702529	missense	probably damaging	0.96
IGL02135:Mroh7	APN	4	106702510	missense	probably damaging	1.00
IGL02335:Mroh7	APN	4	106707782	missense	probably damaging	1.00
IGL02532:Mroh7	APN	4	106720591	missense	probably benign	0.04
IGL02896:Mroh7	APN	4	106699816	missense	possibly damaging	0.94
IGL03066:Mroh7	APN	4	106692398	missense	possibly damaging	0.85
IGL03298:Mroh7	APN	4	106714091	nonsense	probably null
holy	UTSW	4	106709955	splice site	probably null
moley	UTSW	4	106694312	splice site	probably null
P0016:Mroh7	UTSW	4	106707857	critical splice acceptor site	probably null
R0019:Mroh7	UTSW	4	106721426	missense	probably benign	0.07
R0094:Mroh7	UTSW	4	106703184	missense	probably damaging	0.98
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0515:Mroh7	UTSW	4	106691664	missense	probably benign	0.01
R0828:Mroh7	UTSW	4	106699876	missense	probably damaging	0.99
R0831:Mroh7	UTSW	4	106680793	missense	possibly damaging	0.92
R1107:Mroh7	UTSW	4	106707594	unclassified	probably null
R1301:Mroh7	UTSW	4	106720495	missense	probably damaging	0.99
R1456:Mroh7	UTSW	4	106695141	splice site	probably benign
R1491:Mroh7	UTSW	4	106703058	missense	probably benign	0.11
R1540:Mroh7	UTSW	4	106703076	missense	probably benign	0.11
R1560:Mroh7	UTSW	4	106711254	missense	possibly damaging	0.78
R1645:Mroh7	UTSW	4	106720668	missense	probably benign	0.19
R1804:Mroh7	UTSW	4	106694392	missense	possibly damaging	0.76
R2162:Mroh7	UTSW	4	106700181	missense	probably damaging	0.96
R2265:Mroh7	UTSW	4	106720927	missense	probably benign	0.01
R2866:Mroh7	UTSW	4	106691090	missense	probably damaging	1.00
R3716:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R4530:Mroh7	UTSW	4	106720437	missense	possibly damaging	0.71
R4661:Mroh7	UTSW	4	106691513	critical splice donor site	probably null
R4706:Mroh7	UTSW	4	106691624	missense	possibly damaging	0.86
R4910:Mroh7	UTSW	4	106709955	splice site	probably null
R4965:Mroh7	UTSW	4	106690987	missense	possibly damaging	0.77
R4969:Mroh7	UTSW	4	106680873	missense	probably benign
R4971:Mroh7	UTSW	4	106691552	missense	probably benign	0.04
R5083:Mroh7	UTSW	4	106690318	missense	probably benign	0.03
R5207:Mroh7	UTSW	4	106721386	missense	probably damaging	0.97
R5364:Mroh7	UTSW	4	106691643	missense	probably benign	0.10
R5392:Mroh7	UTSW	4	106711251	critical splice donor site	probably null
R5630:Mroh7	UTSW	4	106720567	missense	possibly damaging	0.71
R5691:Mroh7	UTSW	4	106702618	missense	probably damaging	0.96
R5703:Mroh7	UTSW	4	106708560	missense	possibly damaging	0.77
R5707:Mroh7	UTSW	4	106681885	missense	possibly damaging	0.73
R5919:Mroh7	UTSW	4	106694312	splice site	probably null
R5979:Mroh7	UTSW	4	106720926	missense	probably benign	0.00
R6479:Mroh7	UTSW	4	106703188	missense	possibly damaging	0.75
R6520:Mroh7	UTSW	4	106721263	missense	probably benign	0.00
R6657:Mroh7	UTSW	4	106702500	nonsense	probably null
R6732:Mroh7	UTSW	4	106680713	frame shift	probably null
R6817:Mroh7	UTSW	4	106714115	missense	probably benign	0.00
R6980:Mroh7	UTSW	4	106700237	missense	probably benign	0.05
R7062:Mroh7	UTSW	4	106683980	missense	probably damaging	1.00
R7116:Mroh7	UTSW	4	106711320	missense	probably benign	0.07
R7134:Mroh7	UTSW	4	106720594	missense	probably damaging	0.99
R7169:Mroh7	UTSW	4	106691639	missense	probably damaging	0.99
R7419:Mroh7	UTSW	4	106683918	missense	probably benign
R7516:Mroh7	UTSW	4	106691119	missense	probably benign	0.00
R7525:Mroh7	UTSW	4	106709702	missense	probably benign	0.22
R7540:Mroh7	UTSW	4	106720398	missense	possibly damaging	0.85
R7849:Mroh7	UTSW	4	106721090	missense	probably benign
R7932:Mroh7	UTSW	4	106721090	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACCCAGGATAGCTATGCAG -3'
(R):5'- GTCCATGAATGAAAGTCCAAAAGC -3'

Sequencing Primer
(F):5'- TATGCAGCTGGAGAAGGCGTC -3'
(R):5'- TACCTAGAGCTTCAGAAACCAGGG -3'

Posted On

2015-01-23