Incidental Mutation 'R2883:Wdr26'
ID260893
Institutional Source Beutler Lab
Gene Symbol Wdr26
Ensembl Gene ENSMUSG00000038733
Gene NameWD repeat domain 26
SynonymsGid7, 1600024A01Rik
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181173228-181211552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181211120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 102 (D102E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162819] [ENSMUST00000162963]
Predicted Effect probably damaging
Transcript: ENSMUST00000036329
AA Change: D102E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045177
Gene: ENSMUSG00000038733
AA Change: D102E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 43 70 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
LisH 100 132 9.73e-1 SMART
Blast:CTLH 133 183 6e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162819
AA Change: D106E

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124592
Gene: ENSMUSG00000038733
AA Change: D106E

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 211 2.41e-5 SMART
low complexity region 276 287 N/A INTRINSIC
WD40 324 363 4.76e-6 SMART
WD40 370 411 1.35e-5 SMART
WD40 414 454 2.12e-3 SMART
WD40 537 579 2.77e-1 SMART
WD40 582 622 3.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162963
AA Change: D106E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124186
Gene: ENSMUSG00000038733
AA Change: D106E

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 46 73 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
LisH 103 135 9.73e-1 SMART
CTLH 136 195 4.97e-7 SMART
low complexity region 260 271 N/A INTRINSIC
WD40 308 347 4.76e-6 SMART
WD40 354 395 1.35e-5 SMART
WD40 398 438 2.12e-3 SMART
WD40 521 563 2.77e-1 SMART
WD40 566 606 3.83e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Other mutations in Wdr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Wdr26 APN 1 181191816 missense possibly damaging 0.86
IGL01941:Wdr26 APN 1 181211070 splice site probably benign
IGL02612:Wdr26 APN 1 181177796 utr 3 prime probably benign
IGL02660:Wdr26 APN 1 181198898 missense probably damaging 1.00
IGL02685:Wdr26 APN 1 181183780 missense possibly damaging 0.64
IGL02884:Wdr26 APN 1 181182784 missense probably damaging 1.00
R0396:Wdr26 UTSW 1 181180651 intron probably benign
R0453:Wdr26 UTSW 1 181182879 nonsense probably null
R0530:Wdr26 UTSW 1 181186070 splice site probably null
R0729:Wdr26 UTSW 1 181185905 splice site probably null
R1170:Wdr26 UTSW 1 181181294 splice site probably benign
R1466:Wdr26 UTSW 1 181185934 splice site probably benign
R1830:Wdr26 UTSW 1 181191775 missense probably damaging 1.00
R4090:Wdr26 UTSW 1 181203114 missense probably damaging 1.00
R4097:Wdr26 UTSW 1 181182787 missense probably benign 0.00
R4953:Wdr26 UTSW 1 181197651 missense probably damaging 1.00
R5223:Wdr26 UTSW 1 181187686 missense probably benign 0.07
R5834:Wdr26 UTSW 1 181203147 missense probably damaging 1.00
R5884:Wdr26 UTSW 1 181187541 intron probably benign
R6174:Wdr26 UTSW 1 181191868 missense probably damaging 1.00
R6334:Wdr26 UTSW 1 181203206
R7161:Wdr26 UTSW 1 181203130 missense probably damaging 1.00
R7255:Wdr26 UTSW 1 181181324 missense probably benign 0.24
R7406:Wdr26 UTSW 1 181187675 missense probably damaging 1.00
R7804:Wdr26 UTSW 1 181182822 missense probably damaging 1.00
R7815:Wdr26 UTSW 1 181209073 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AAGACATCGGGCCGATTCC -3'
(R):5'- GAAACTCTGGCCTCCGCTTC -3'

Sequencing Primer
(F):5'- GGGCCGATTCCCTTTCCTAGAC -3'
(R):5'- AGAACGGGGAGTCGTCC -3'
Posted On2015-01-23